Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system
A technology of resveratrol and stilbene synthase, applied in the field of bioengineering, can solve problems such as high technical requirements, bacterial infection, and high inoculation work intensity, and achieve low transfection efficiency, simple operation process, and broad market prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0037] Experimental Example 1: Acquisition of resveratrol stilbene synthase gene.
[0038] Grape buds were used as materials, total RNA was extracted by Trizol method, cDNA was obtained by reverse transcription with Oligo (dT18) primer, and RT-PCR was performed to amplify the resveratrol stilbene synthase gene. The primers were as follows:
[0039] Upstream primer: 5′-GGAAGGATCCATGCCGAATTATTCATACACCCCCCACCATCCAACGTGCCAAGGGTCC GGC;
[0040] Downstream primer: 5'-GGGCGTCGACTTAATTTGTAACCATAGC.
[0041] The PCR reaction system is:
[0042] wxya 2 O 20 μL
[0043] 10×PCR buffer
[0044] 2.5μL
[0045] (25mmol / L MgCl 2 )
[0046] 2.5mmol / L dNTP 0.5μL
[0047] Primer 1 0.5 μL
[0048] Primer 2 0.5 μL
[0049] Taq polymerase 0.5 μL
[0050] cDNA template 0.5 μL
[0051] Total 25μL
[0052] The reaction procedure of PCR is:
[0053] Pre-denaturation at 94°C for 5 minutes
[0054]
[0055] 72°C 10min
[0056] Finally stored at 4°C.
[0057] Pur...
Embodiment 2
[0058] Example 2 Preparation of Recombinant Bombyx mori Baculovirus
[0059] 1. Double digestion of pFast HTA and purified PCR product
[0060] In a sterile Eppendorf tube, sequentially add:
[0061] 10× buffer 5 μL
[0062] pFastBac HTA 42.5 μL
[0063] BamH I 1.5 μL
[0064] Sal I 1 μL
[0065] Total 50μL
[0066] 10× buffer 5 μL
[0067] Purified PCR product 42.5 μL
[0068] BamH I 1.5 μL
[0069] Sal I 1 μL
[0070] Total 50μL
[0071] Incubate at 37°C for 4 hours before use.
[0072] 2. Enzyme digestion product treatment
[0073] For the reaction system after double enzyme digestion, inactivate the restriction endonuclease in a 70°C water bath for 10 minutes. 1% gel electrophoresis, and the small fragments after PCR digestion and the large fragments of the pFastBac HTA vector were recovered by slicing the gel respectively. Purify and recover separately using a gel recovery kit.
[0074] 3. Ligation reaction
[0075] The purified PCR product was ligated with...
experiment example 3
[0101] Experimental Example 3 Inoculation of recombinant virus and purification of recombinant enzyme
[0102] 1. Vaccination
[0103] Use 3-day-old pupae as the inoculation object, disinfect the silkworm pupae epidermis (70% alcohol, edible alcohol), and puncture inoculate with about 100 pfu of recombinant virus per head. Under clean conditions, store at 28°C for 5-7 days, harvest silkworm chrysalis and store them at -20°C for later use.
[0104] 2. Purification of Recombinase
[0105] 1) silkworm chrysalis homogenate
[0106] a) Thaw raw silkworm chrysalis at 4°C (about 30 minutes), mix them with 0.85% normal saline at a weight ratio of 1:1; homogenize for 9 minutes until the slurry is fine and uniform;
[0107] 2) Low-speed centrifugation (using R10A3 rotor), followed by:
[0108] b) Add the homogenate into a 500ml centrifuge tube, balance, put the R10A3 rotor into the centrifuge, centrifuge at 3000rpm for 30min, take the supernatant, and carefully discard the oil;
[...
PUM
Property | Measurement | Unit |
---|---|---|
particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com