Novel technology for detecting viruses of arbovirus encephalitis
A technology of encephalitis virus and insect vector, applied in the field of virus molecular biology, can solve the problems of automation and high-throughput obstacles, easy delay in diagnosis, low specificity, etc., and achieve simple and stable reagent consumables, reduced use, and high sensitivity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] In the present embodiment, a method for detecting 8 kinds of arboencephalitis viruses is provided, the method includes the following steps:
[0066] (1) Obtain target sequence amplification products by PCR amplification. The PCR amplification primer pair used herein is the following primer pair with the tag sequence acgttggatg (SEQ ID NO: 25) connected to the 5' end: SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, and SEQ ID NO: 15 and 16; using extension primer SEQ ID NO : 17-24 are shown in Table 3 respectively.
[0067] Table 3: Extension primers for the 8 arboviruses used in this example.
[0068] SEQ ID NO:
Primer sequence 5'→3'
extended base
17
AGCTGCTGGAAAGAACCT
A
18
TCCCTATGGACCAGAAATGA
C
19
GCTTTGGCGACCACATGGAAA
G
20
CTCCCTTTTTGGAACCATTGGTG
A
21
TGGCACATACGTGCACACGGGAAA ...
Embodiment 2
[0089] In this embodiment, all the steps and processing methods are the same as those in Embodiment 1 except for the sample pre-treatment. The sample in this embodiment is TBEV pure virus, utilizes the E.Z.N.A. of Omega Company. Viral RNA Kit was used to extract sample RNA, and the operation steps were performed according to the kit instructions. Using PrimeScript purchased from Takara The RT reagent Kit reverse-transcribes the extracted RNA sample into cDNA.
[0090] The steps are the same as steps (1)-(5) in Example 1, except that the template DNA used in the PCR amplification reaction system of step (1) is the above-mentioned template cDNA.
[0091] The following combination Figure 9 with Figure 10 , to analyze and explain the cDNA detection results of TBEV pure virus culture samples and mixed cDNA detection results of TBEV, JEV, WEEV and RabV pure virus culture samples.
[0092] from Figure 9 It can be seen that when TBEV pure virus cDNA is used as a template, M...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com