Recombinant bacillus calmette guerin vaccine for toxoplamasis and preparation method thereof
A technology of recombinant BCG and Toxoplasma gondii, which is applied in the field of preparation of Toxoplasma recombinant BCG vaccine, can solve the problems of weak anti-infection ability and inapplicability to human beings, and achieve easy transportation and storage, strong humoral immune adjuvant effect, thermal good stability effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Preparation of Toxoplasma gondii recombinant BCG vaccine of the present invention
[0026] Taking the protective antigen Cyclophilin gene of Toxoplasma gondii as an example, the shuttle expression vector and the integrated expression vector were constructed.
[0027] 1. The preparation steps of the recombinant BCG vaccine of the shuttle expression vector Toxoplasma gondii:
[0028] According to the Cyclophilin gene DNA sequence and the physical map of the shuttle vector pMV261, two pairs of primers were designed and restriction restriction sites were introduced.
[0029] Upstream primer QF1: 5'- GAATTCATGAAGCTCGTGCTGTTTTTCCT -3'; the 5' end contains an EcoRI site;
[0030] Downstream primer QR: 5'- GTCGACTTACTCCAACAAACCAATGTCCGT -3'; the 5' end contains a SalI site.
[0031] The PCR purified product was cloned into the pMD18-T vector and identified by PCR, enzyme digestion and sequencing. The fragment recovered from the gel was ligated with the shuttle expression vect...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com