Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction and applications of cell model expressing human organic cation transporter-1

A cell model and cell technology, applied in the direction of cells modified by introducing foreign genetic material, application, microorganism measurement/inspection, etc., can solve problems such as unclear three-dimensional structure

Active Publication Date: 2011-09-14
ZHEJIANG UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The multi-specific organic cation transporter OCT1 (SLC22A1) in this family is a glycoprotein containing 554 amino acids, including 12 transmembrane regions, and the N-terminal and C-terminal are located inside the cell membrane. There is a large extracellular loop of glycosylation between the first transmembrane structures and a phosphorylation extracellular loop between the sixth and seventh transmembrane structures [1] , its three-dimensional structure is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and applications of cell model expressing human organic cation transporter-1
  • Construction and applications of cell model expressing human organic cation transporter-1
  • Construction and applications of cell model expressing human organic cation transporter-1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Preparation of target gene

[0026] 1.1 Obtaining the wild-type target gene

[0027] (1) Design two PCR primers according to the DNA sequence of human OCT1. The upstream and downstream primers respectively design a restriction site, BamHI, XhoⅠ (underlined)

[0028] SEQ ID No:4 upstream primer: ATG GGATCC ATGCCCACCGTGGATGACAT

[0029] SEQ ID No:5 downstream primer: ATG CTCGAG TCAGGTGCCCGAGGGTTCT

[0030] (2) Total RNA was extracted from human liver tissue by TRIzol method, cDNA was obtained by RT-PCR, and the target gene fragment was obtained using cDNA as a template.

[0031]

[0032] The PCR result was identified by 1% agarose gel electrophoresis, and a band with a length of about 1.7kb was obtained (see figure 1 A), the position is correct, and the target gene is considered to be obtained.

[0033] (3) Gel recover the PCR product at the correct position, and perform A addition reaction on the recovered product. The reaction product is identified by ele...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method and applications of a cell model expressing human organic cation transporter-1. A hOCT1 wild-type gene segment is obtained from a hepatic tissue; two mutant gene segments P341L and M420del can be obtained by specific point mutation; the two segments are connected with a plasmid vector; darby canine kidney cells (MDCK) are transfected; G418 resistance screening is carried out to obtain wild-type cells expressing hOCT1 and cells of two mutants; mRNA level verification is carried out on the cells; and functional verification is carried out by utilizing a hOCT1 substrate and an inhibitor. The cell model provided by the invention can be used for screening the hOCT1 classic substrate and the inhibitor, and predicting the transportation of medicament in human bodies and medicament interaction which possibly happen; and by utilizing the cell model, the influence of gene polymorphism of the transporter on the medicament transportation function can be predicted; and the cell model provides a standard for clinical reasonable medicament administration and individualized medicament administration, and has reasonable design and good repetitiveness.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to the construction and application of Martin Darby dog ​​kidney epithelial cell (MDCK) model stably expressing wild-type and mutant human organic cation transporter 1 (hOCT1). technical background [0002] Membrane transporters are a class of proteins that are widely distributed on cell membranes and specifically mediate the entry and exit of exogenous and endogenous chemical substances through active or passive mechanisms. They generally have saturation and substrate specificity. Membrane transporters provide a new and promising direction for people to conduct drug research, especially in pharmacodynamics, pharmacokinetics, new drug development, and drug targeting design. The organic cation / anion / zwitterion transporter family (SLC22) plays an important role in the transport and clearance of many endogenous amines and exogenous substances, including many clinically used drugs. T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/63C12N15/66C12N5/10C12Q1/02G01N21/64
Inventor 涂美娟陈忠坚石爱琴孙思源李丽萍曾苏蒋惠娣
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products