One-step detection method of genetic mutation and B-raf genetic point mutation, and kit thereof
A detection method and step-by-step technology, applied in the field of molecular biology, can solve the problems of immature detection methods and lack of gene mutation detection, and achieve the effect of improving detection sensitivity and specificity and reducing operation steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1. Primer and probe design
[0025] 1) Enrichment primer design
[0026] Design primers that can amplify 400-500bp fragments, the relevant parameters are: Tm value 65.0°C-68.0°C, GC value 40.0%-65.0%, primer size 23±3bp. The designed enrichment primer sequences are as follows:
[0027] Enrichment upstream primer: CATCCTAACACATTTCAAGCCCCCA (SEQ ID NO: 1)
[0028] Enrichment downstream primer: GAACACTGATTTTTGTGAATACTGGGAAC (SEQ ID NO: 2)
[0029] 2) ARMS primer design
[0030] Design primers that can amplify a fragment of 80-120bp, the relevant parameters are: Tm value 55.0°C-60.0°C, GC value 40.0%-60.0%, primer size 20±3bp. The 3' end of the upstream ARMS primer is located at the mutation site and matches the mutant gene. In order to improve the specificity, a mismatched base is introduced at the fourth base of the 3' end. The designed ARMS primer The sequence is as follows:
[0031] ARMS upstream primer: GGTGATTTTGGTCTAGCTATAGA (SEQ ID NO: 3)
[0032] ARM...
Embodiment 2
[0037] Example 2. One-step detection method of ARMS fluorescent quantitative PCR for mutation enrichment of V600E point mutation
[0038] The mutation enrichment ARMS one-step detection method of the present invention integrates enzyme digestion, PCR enrichment and ARMS fluorescence quantitative PCR technology, that is, enzyme digestion, PCR enrichment and ARMS fluorescence quantitative PCR identification are independently performed in one reaction system, and the specific process is as follows: Put 25 μl of the reaction system including the components in the following table on the PCR machine (wherein the sample genomic DNA is the genomic DNA extracted from colorectal cancer tissue) and incubate at 37°C for 30 minutes, and the endonuclease TspRI specifically digests B-raf The part to be detected of the wild-type allele (this part contains a restriction enzyme recognition site for TspRI), but the part to be detected of the V600E mutant gene of the B-raf gene cannot be digested ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com