Fusion protein and encoding gene thereof as well as application of fusion protein

A fusion protein and protein technology, applied in the direction of hybrid peptides, medical preparations with non-active ingredients, medical preparations containing active ingredients, etc., can solve the problems of antigenic variation, influenza prevention and control difficulties, etc.

Inactive Publication Date: 2011-07-27
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These vaccines are mainly aimed at the membrane proteins hemagglutinin (HA) and neuraminidase (NA) of the virus; HA and NA are the main transmembrane proteins of influenza virus and have good immunogenicity, but due to their frequent occurrence of antigenic Drift and antigenic transformation, its antigenicity has great variation, and the strains used for vaccine preparation must be constantly replaced, which brings great difficulties to the prevention and control of influenza

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein and encoding gene thereof as well as application of fusion protein
  • Fusion protein and encoding gene thereof as well as application of fusion protein
  • Fusion protein and encoding gene thereof as well as application of fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0030] 1. Cloning of Pseudomonas aeruginosa exotoxin A gene

[0031] Pseudomonas aeruginosa (preservation number ATCC27583) comes from the Clinical Laboratory Center of the Ministry of Health. Pseudomonas aeruginosa was cultured in broth medium at 37°C. The cells were harvested and the genomic DNA of Pseudomonas aeruginosa was extracted.

[0032] The exotoxin A gene sequence was amplified from the genomic DNA of Pseudomonas aeruginosa by PCR method.

[0033] PCR primers: 5'CGGAATTCATATGCACCTGACAC 3' (SEQ ID NO 1); 5'AACTGCAGTTACTTCAGGTCCTC 3' (SEQ ID NO 2).

[0034] The PCR reaction volume is 50ul, and the reaction conditions are: first 94°C, 5min; then 94°C, 45sec, 56°C 1min, 72°C 2min; after 30 cycles, 72°C extension for 10min.

[0035] Obtain the PCR product, connect the PCR product to the pGEM-T vector to obtain the cloning vector pGEM-PEA, and transform Escherichia coli DH5α.

[0036] A single colony was picked and identified by PCR, and then the positive clones were ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a fusion protein and an encoding gene thereof as well as an application of the fusion protein. The fusion protein is obtained by fusing an unnecessary domain or carboxyl terminal of pseudomonas exotoxin A with 1-3 extracellular domains of a copied influenza A virus M2 protein, wherein the amino acid sequence of the pseudomonas exotoxin A is a part selected from the 1st-392nd positions and the 407th-657th positions from an amino terminal of a sequence 15 in a sequence table. The invention also discloses a gene for encoding the fusion protein. The fusion protein can be used for preparing influenza A virus vaccines. The fusion protein can stimulate an organism to generate M2 polyclonal antibodies and can stimulate the organism to generate cell immune responses aimingat M2e.

Description

technical field [0001] The present invention relates to a fusion protein and its encoding gene and application. Background technique [0002] Influenza is a respiratory infectious disease caused by influenza virus. Influenza epidemics cause about 250,000 to 500,000 deaths worldwide almost every year, and bring a great economic burden. Influenza virus belongs to the Orthomyxoviridae family and is a segmented RNA virus with three membrane proteins: hemagglutinin (HA), neuraminidase (NA) and matrix protein 2 (M2). The currently used human influenza vaccine is a triple inactivated vaccine against H1N1 subtype, H3N2 subtype and B influenza virus of influenza A virus, including whole virus inactivated vaccine, split vaccine and purified virus surface antigen subunit vaccine. These vaccines are mainly aimed at the membrane proteins hemagglutinin (HA) and neuraminidase (NA) of the virus; HA and NA are the main transmembrane proteins of influenza virus and have good immunogenicity,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62A61K39/145A61K47/48A61P31/16A61K47/64
Inventor 张智清徐一刘晓宇郭建强姚立红陈爱君
Owner STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap