Construction and application of porcine circovirus type II-porcine mycoplasma pneumoniae expressing strains
A technology of Mycoplasma hyopneumoniae and porcine circovirus, which is applied in the biological field, can solve the problems of restricting the popularization and use of vaccines, high cost of vaccine production, special immunization routes, etc., and achieves the effects of remarkable immunization effect, manpower saving, and good immunization safety.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Construction of porcine circovirus type II-mycoplasma hyopneumoniae prokaryotic expression strain
[0036] (1) Amplification and cloning of PCV2CAP gene and Mhp R1 gene
[0037] A. Primer design
[0038] According to the whole genome sequence of PCV2 in Genebank, primers were designed to express the ORF2 gene sequence of CAP protein, and a restriction site was added to the designed primer according to the restriction site of the selected prokaryotic expression vector pET-28a (+), Its primer sequence is as follows:
[0039] CAP-P1: 5'CAAGCTTGCATGACGTATCCAAGGA'3
[0040] CAP-P2: 5'GTGCGGCCGCTTAAGGGTTAAGTGG'3
[0041] Design the primers of the gene sequence of the repeat region R1 according to the whole genome sequence of Mhp in Genebank, and add restriction sites in the designed primers according to the restriction sites of the selected prokaryotic expression vector pET-28a (+), Its primer sequence is as follows:
[0042] R1-P1: 5'GCGGATCCGCAGCAAAACCAGAAGC'...
Embodiment 2
[0053] Example 2 Induction and mass production of expression product of porcine circovirus type II-mycoplasma hyopneumoniae prokaryotic expression strain
[0054] (1) Induced expression of prokaryotic expression strains
[0055] The screened positive bacteria were screened for induction. Method: a. Inoculate 5 mL of 2xYT medium with Kan resistance with the preserved bacterial solution at a ratio of 1:1000, and culture overnight at 37°C for 14 hours. One tube of empty plasmid bacteria should be inoculated as a control. b The next day, inoculate the overnight cultured fresh bacteria into 5mL 2xYT medium with Kan resistance at a ratio of 1:1000, inoculate two tubes for each bacteria, one for induction and one for non-induced control, at 37°C Cultivate for 3h. Make OD 600nm The value reaches 0.4-0.5. c Then one of the tubes was added with inducer IPTG to make the final concentration 1mmol / l, and cultured at 37°C for 5h. d Take 1.5 mL of each bacteria into an eppendorf tube, ...
Embodiment 3
[0062] Example 3 Vaccine preparation of porcine circovirus type II-mycoplasma hyopneumoniae prokaryotic expression strain expression product
[0063] (1) Preparation of antigens for production
[0064] The protein prepared according to Example 2 was used as an antigen for vaccine production.
[0065] (2) Emulsification of antigen
[0066] The antigen for production is added into the oil adjuvant according to the ratio of 1:1 (antigen: oil adjuvant), and emulsified to obtain the experimental vaccine.
[0067] The oil adjuvant used is prepared as 90wt% white oil and 10wt% Siben-80. Aluminum stearate is added to the oil adjuvant mixed solution, wherein the amount of aluminum stearate added is 1 g / 100 ml oil adjuvant mixed solution . In this example, a total of 1 batch of porcine circovirus type II-Mycoplasma hyopneumoniae vaccines were prepared, and the prepared vaccines passed the physical property inspection, safety inspection, and efficacy inspection.
[0068] The quality ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com