DNA fragment for inhibiting expression of omega secaline gene in wheat 1B/1R translocation line and application thereof
A technology of gene expression and translocation, applied in the field of plant genetic engineering, can solve the problems of difficult realization of omega-rye alkali gene, poor adaptability, low yield of wheat, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Preparation of DNA fragments for silencing ω-ryeline gene
[0028] According to the sequences of the coding regions of different members of the omega-ryeline gene published in the journal Cell Research (Chai et al., Cell Research, 2005, 15(8):658-664), select a relatively conserved segment at 5′ to design a pair of primers , P3-1: ttcccgggccttcctcatctttgtcct (the part in bold is the added Sma I restriction sequence), P4-1: taggatccgctctggtctctggggttg (the part in bold is the added BamH I restriction site), based on the genome of wheat 1B / 1R translocation line Lankao 906 DNA was used as a template for PCR amplification, and the amplification parameters were: 94°C for 4 minutes, 94°C for 45 seconds, 65°C for 45 seconds, 72°C for 1 minute, 30 cycles, and 72°C for 7 minutes. The PCR amplification products were cloned with the pBS-T cloning kit of Tiangen Biochemical Technology (Beijing) Co., Ltd., and some positive clones were selected for sequencing. One of the...
Embodiment 2
[0032] Embodiment 2: Construction of RNAi genetic expression vector
[0033] The GUS gene was excised from the basic plant binary expression vector pAHC25 (Christensen AH and Quail PH, Transgenic Research, 1996, 5:213-218) with Sma I / Sac I double enzyme digestion, and then connected to the same double enzyme digestion from the recombinant The fragment of SEQ ID NO.1 excised from the vector pBS-T-Sec was used to obtain a new recombinant expression vector pAHC25-Sec. The promoter used in this expression vector is maize Ubiquitin, and the plant resistance screening gene is BAR gene, which can be used directly Genetic transformation mediated by gene gun or pollen tube.
Embodiment 3
[0034] Embodiment 3: Construction of RNAi genetic expression vector
[0035] The GUS gene was excised from the basic plant binary expression vector pAHC15 (Christensen AH and Quail PH, Transgenic Research, 1996, 5:213-218) with Sma I / Sac I double enzyme digestion, and then connected to the same double enzyme digestion from the recombinant The fragment of SEQ ID NO.1 excised from the vector pBS-T-Sec was used to obtain a new recombinant expression vector pAHC15-Sec. The promoter used in this expression vector was maize Ubiquitin, which did not contain a plant resistance screening gene and could be used with plants containing The expression vector pAHC20 (Christensen AH and Quail PH, Transgenic Research, 1996, 5:213-218) of the resistance screening marker BAR gene was used for gene gun co-transformation.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com