Kit for aided identification of Plum Pox virus and application thereof
A plum pox virus and auxiliary identification technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, fluorescence/phosphorescence, etc., can solve the problems of difficult to determine the copy number of the initial template, false positives, etc., to avoid contamination and human body damage, quantitative identification, and high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1, the preparation of kit
[0034] The kit consists of specific primer pairs and specific probes.
[0035] Specific primer pairs are as follows:
[0036] Upstream primer (F): 5'-ACTACAGCCTCGCCAGATATG-3' (sequence 1 of the sequence listing);
[0037] Downstream primer (R): 5'-TTTCCATCCAAGCCAAATAAACG-3' (Sequence 2 of the Sequence Listing).
[0038] The pair of specific primers is aimed at nucleotides 677-815 (139 bp) of the 5' end of the CP gene of plumpox virus shown in sequence 4 or sequence 5 of the sequence listing.
[0039] The specific probe (TaqMan probe) (the nucleotide sequence is sequence 3 in the sequence listing) is as follows:
[0040] 5'-(FAM)CTCAATGCTGCTGCCTTCATCTGGA(Eclipse)-3'.
Embodiment 2
[0042]Embodiment 2, the sensitivity measurement of kit
[0043] 1. Preparation of standard curve
[0044] 1. Using the total RNA of PPV as a template, perform PCR amplification with a primer pair composed of PPV-F and PPV-R to obtain a PCR amplification product.
[0045] PPV-F: 5'-CCACCTCCAGTCATACAG-3';
[0046] PPV-R: 5'-AGATACCGAGACCACTACAC-3'.
[0047] The target sequence of PPV-F and PPV-R is the full sequence DNA of the CP gene of plum pox virus shown in sequence 4 of the sequence listing.
[0048] 2. Perform electrophoresis on the PCR amplification product in step 1, cut the gel and recover, and obtain purified DNA.
[0049] 3. Ligate the purified DNA to the pMD18-T vector to obtain the ligation product.
[0050] 4. The ligation product was transformed into Escherichia coli DH5a competent cells, the recombinants were screened, and the plasmid was extracted for PCR identification and sequencing. The results showed that the recombinant plasmid containing the DNA shown ...
Embodiment 3
[0072] Embodiment 3, the specificity determination of kit
[0073] 1. Extraction of viral RNA
[0074] Extract the total RNA of the three viruses (PPV, PVX, PVY) respectively: use the RNA extraction kit (Plant Virus Nucleic Acid Trizol Extraction Kit) to extract the total RNA of the virus to obtain the virus RNA liquid; measure it with a NanoDrop ND-2000 Spectrophotometer quantitative analyzer The concentration and the final concentration are uniformly 1000ng / ul.
[0075] 2. Synthesis of cDNA
[0076] The cDNA of each virus was synthesized respectively, and the cDNA synthesis system was the same as step 2 of Example 2.
[0077] 3. Real-time fluorescent PCR amplification
[0078] The cDNA solution in step 2 was used as a template, and the kit of Example 1 was used to perform real-time fluorescent PCR. The real-time fluorescent PCR reaction system and PCR program are the same as Step 1-6 of Example 1.
[0079] see results figure 2 . PPV showed a typical amplification cur...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap