Kit for aided identification of Plum Pox virus and application thereof

A plum pox virus and auxiliary identification technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, fluorescence/phosphorescence, etc., can solve the problems of difficult to determine the copy number of the initial template, false positives, etc., to avoid contamination and human body damage, quantitative identification, and high detection sensitivity

Inactive Publication Date: 2010-12-29
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the commonly used methods for detecting PPV are mainly ELISA, ordinary RT-PCR, multiplex PCR and other methods, but some of these methods have the problem of false positives, and some are difficult to determine the copy number of the starting template

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for aided identification of Plum Pox virus and application thereof
  • Kit for aided identification of Plum Pox virus and application thereof
  • Kit for aided identification of Plum Pox virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, the preparation of kit

[0034] The kit consists of specific primer pairs and specific probes.

[0035] Specific primer pairs are as follows:

[0036] Upstream primer (F): 5'-ACTACAGCCTCGCCAGATATG-3' (sequence 1 of the sequence listing);

[0037] Downstream primer (R): 5'-TTTCCATCCAAGCCAAATAAACG-3' (Sequence 2 of the Sequence Listing).

[0038] The pair of specific primers is aimed at nucleotides 677-815 (139 bp) of the 5' end of the CP gene of plumpox virus shown in sequence 4 or sequence 5 of the sequence listing.

[0039] The specific probe (TaqMan probe) (the nucleotide sequence is sequence 3 in the sequence listing) is as follows:

[0040] 5'-(FAM)CTCAATGCTGCTGCCTTCATCTGGA(Eclipse)-3'.

Embodiment 2

[0042]Embodiment 2, the sensitivity measurement of kit

[0043] 1. Preparation of standard curve

[0044] 1. Using the total RNA of PPV as a template, perform PCR amplification with a primer pair composed of PPV-F and PPV-R to obtain a PCR amplification product.

[0045] PPV-F: 5'-CCACCTCCAGTCATACAG-3';

[0046] PPV-R: 5'-AGATACCGAGACCACTACAC-3'.

[0047] The target sequence of PPV-F and PPV-R is the full sequence DNA of the CP gene of plum pox virus shown in sequence 4 of the sequence listing.

[0048] 2. Perform electrophoresis on the PCR amplification product in step 1, cut the gel and recover, and obtain purified DNA.

[0049] 3. Ligate the purified DNA to the pMD18-T vector to obtain the ligation product.

[0050] 4. The ligation product was transformed into Escherichia coli DH5a competent cells, the recombinants were screened, and the plasmid was extracted for PCR identification and sequencing. The results showed that the recombinant plasmid containing the DNA shown ...

Embodiment 3

[0072] Embodiment 3, the specificity determination of kit

[0073] 1. Extraction of viral RNA

[0074] Extract the total RNA of the three viruses (PPV, PVX, PVY) respectively: use the RNA extraction kit (Plant Virus Nucleic Acid Trizol Extraction Kit) to extract the total RNA of the virus to obtain the virus RNA liquid; measure it with a NanoDrop ND-2000 Spectrophotometer quantitative analyzer The concentration and the final concentration are uniformly 1000ng / ul.

[0075] 2. Synthesis of cDNA

[0076] The cDNA of each virus was synthesized respectively, and the cDNA synthesis system was the same as step 2 of Example 2.

[0077] 3. Real-time fluorescent PCR amplification

[0078] The cDNA solution in step 2 was used as a template, and the kit of Example 1 was used to perform real-time fluorescent PCR. The real-time fluorescent PCR reaction system and PCR program are the same as Step 1-6 of Example 1.

[0079] see results figure 2 . PPV showed a typical amplification cur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a kit for aided identification of Plum Pox virus and application thereof. The kit provided by the invention comprises a special primer pair and / or a special probe, wherein the special primer pair is the primer pair consisting of the DNAs presented by sequence 1 and sequence 2; and the nucleotide sequence of the special probe is presented by sequence 3. The kit of the invention can quickly, detect the Plum Pox virus accurately, stably and quantitatively, can judge whether a sample contains the Plum Pox virus or not according to the fluorescent signal generation condition, and can judge whether the content of the Plum Pox virus in the sample is high or low according to the size of the signal value. The kit has the advantages of strong specificity, high accuracy, simple and convenient operation in a detection process, short time required by detection and the like, and is suitable for quarantine inspection stations, port inspection and quarantine bureaus, plant virus research institutions and the like of agriculture department.

Description

technical field [0001] The invention relates to a kit for assisting identification of plum pox virus and its application. Background technique [0002] Plum pox virus (PPV) is a member of the genus Potatovirus, and its virions are in the shape of curved rods with a size of 700nm×11nm. It is a quarantine pest in my country. Under natural conditions, PPV has a wide range of hosts and can infect 46 species of woody plants and 150 species of herbaceous plants. Various stone fruit trees such as plums, peaches, apricots and cherries can be affected. Plum pox virus has a wide distribution and has been reported in the United States, Canada, Japan, Egypt, India, Syria, Turkey, Chile, and many European countries. Plum pox virus can be transmitted by aphids in a non-persistent manner, and the spread speed is fast, which may bring disastrous consequences to the development of the entire domestic stone fruit industry in a short period of time. Strengthening the quarantine monitoring of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor 李明福高雅红王进忠李桂芬张永江
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products