Kit for detecting SNP locus of gene associated with individualized medication of warfarin and PCR amplification method thereof
A kit and gene technology, applied in the field of kits for detection of SNP sites of genes related to warfarin individualized medication and its PCR amplification, can solve the problems of low specificity, high price, low efficiency, etc. Achieve high specificity, save capital, and improve experimental efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Embodiment 1: A kit for detecting single nucleotide polymorphism sites in genes associated with warfarin individualized medication comprising: 10×PCR Buffer, dNTP (2.5mM), Pfu DNA polymerase (2.5U / μl) and primers (10 mM each).
[0048] The base sequence of the primers for detecting the SNP site of the gene VKORC1 (-1639G / A) is as follows:
[0049] Forward primer: CCTGAAAAACAACCATTGGTCG (VKORC1-1639Gss);
[0050] CCTGAAAAACAACCATTGGTCA (VKORC1-1639Ass);
[0051] Reverse primer: AGTTTGGACTACAGGTGCCTG (VKORC1-1639R).
[0052] The base sequence of the primers for detecting the SNP site of gene CYP2C9(1075A / C) is as follows (5'→3'):
[0053] Forward primer: TGCACGAGGTCCAGAGATACAT (CYP2C9 1075Ass);
[0054] TGCACGAGGTCCAGAGATACCT (CYP2C9 1075Css);
[0055] Reverse primer: ACTGGAAACAAGAGAAAGTCCA (CYP2C9 1075R).
[0056] The -1, -2, -3 bases at the 3' end of the four forward primers were modified by phosphorothioation.
Embodiment 2
[0057] Example 2: A PCR amplification method used in a kit for detecting single nucleotide polymorphism sites of warfarin individualized drug-related genes
[0058] Include the following steps:
[0059] Step 1: Prepare DNA
[0060] (1) A blood sample is drawn from patient A.
[0061] (2) To obtain DNA from blood samples, we used the UNIQ-10 kit produced by Shanghai Bioengineering Technology Co., Ltd. for extraction.
[0062] Procedure for obtaining DNA from patient A's blood sample:
[0063] a. Take 500ul of blood samples that have been added with ACD (0.48% Citric Acid (citric acid); 1.32% Sodium Citrate (sodium citrate); 1.47% Glucose (glucose)) anticoagulant.
[0064] b. Add 1ml sterile water to 500ul blood sample, centrifuge at 5000 rpm for two minutes to remove the supernatant, and suspend the white blood cells with 200ulTE.
[0065] c. Add 200ul Digestion Buffer to the 200ul sample prepared in step b and mix well, then add 20ul Proteinase K (10mg / ml), mix well, and s...
Embodiment 3
[0087] Example 3: A PCR amplification method used in a kit for detecting single nucleotide polymorphism sites of warfarin individualized drug-related genes
[0088] A blood sample was drawn from Patient B. Other experimental conditions are the same as in Example 2.
[0089] The result is: the gel electrophoresis obtained by using the primers to detect the SNP site of the gene VKORC1 (-1639G / A) is as attached figure 1 As shown in the middle of , there are products in both Ass and Gss lanes, indicating that the patient is heterozygous for the VKORC1(-1639A / G) mutation, and the patient is more sensitive to warfarin. The patient should appropriately reduce the dose of warfarin. The results can be attached by DNA sequencing image 3 Confirmed (sequencing with reverse primer).
[0090] The gel electrophoresis obtained by using primers to detect the SNP site of the gene CYP2C9 (1075A / C) is shown in the attached Figure 5 As shown in the middle of , there is only product in the As...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com