Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA

A detection kit and detection primer technology, applied in DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of loss of morphological characteristics, difficulty in identification of tiger and leopard products, etc., and achieve the effect of low cost

Inactive Publication Date: 2010-09-29
徐君怡 +2
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In the process of wild animal evidence collection, in some cases the products lost their identifiable morphological characteristics after processing, making the identification of tiger and leopard products very difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA
  • PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA
  • PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Establishment of PCR detection kit and detection method for tiger and leopard DNA

[0029] 1. Design of PCR detection primers for tiger and leopard DNA

[0030] According to the differences in mtDNA cytochrome b gene sequences between tigers and leopards and other cats and mammals, and the principle of primer design, the primer sequences designed for detection are as follows:

[0031] Forward primer (SEQ ID NO. 1): 5'GAATATACTATGGCTCCTACAC 3',

[0032] Reverse primer (SEQ ID NO. 2): 5'GGTTGGCGGGGATGTAGTTA 3'.

[0033] 2. Construction of PCR detection kit for tiger and leopard DNA

[0034] On the basis of obtaining the above-mentioned specific primer pairs, a kit for PCR detection of tiger and leopard DNA is designed. The detection solution contains 10×PCR buffer, 10μmol / L forward primer, 10μmol / L reverse primer, 10mmol / L dNTP, 5U / μL Taq DNA polymerase; wherein the forward primer sequence is SEQ ID NO. 1, and the reverse primer sequence is SEQ ID NO.2.

[0035] 3. Establi...

Embodiment 2

[0053] Example 2 Specific Experiment

[0054] The detection kit and detection method containing specific primers of Example 1 were used to detect tiger-derived and leopard-derived DNA samples. Simultaneously detect the DNA samples of lions, bears, cows and other animals to evaluate the specificity of the method.

[0055] Test results: The PCR electrophoresis patterns of tiger and leopard species-specific test results are as follows figure 1 As shown, figure 1 Middle: 1.H 2 O, 2. Siberian tiger blood, 3. Siberian tiger meat, 4. Indochinese tiger blood, 5. Bengal tiger blood, 6. Leopard blood, 7. Snow leopard blood, 8. Asian lion blood, 9. East African lion blood, 10 Black bear blood, 11. Beef bone meal, 12. Sheep bone meal, 13. Pork bone meal, 14. Donkey bone meal, 15. Rabbit bone meal, 16. Deer bone meal, 17. Horse bone meal, 18. Dog bone meal. The test results showed that the blood and muscle tissue DNA samples of the tiger and leopard species, the blood and muscle tissue DNA sam...

Embodiment 3

[0056] Example 3 Sensitivity experiment

[0057] For the extracted Siberian tiger blood DNA and Leopard blood DNA template, the concentration and purity were detected by an ultraviolet spectrophotometer. Adjust the initial concentration to 100ng / μL with TE solution, and perform a 10-fold gradient dilution. The concentrations are: 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL and 1pg / μL. Different concentrations of templates are subjected to PCR reactions to determine the sensitivity of detection.

[0058] The test was carried out according to the PCR reaction conditions, and the results of Siberian tiger blood DNA test were as follows figure 2 As shown, figure 2 Medium: 1.100ng / μL tiger blood DNA, 2.10ng / μL tiger blood DNA, 3.1ng / μL tiger blood DNA, 4.100pg / μL tiger blood DNA, 5.10pg / μL tiger blood DNA, 6.1pg / μL tiger blood DNA, 7.0.1pg / μL tiger blood DNA. The test results show that specific PCR amplified bands can be detected in 100ng / μL, 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL Siberian tiger...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a PCR detection primer, a kit and a detection method for tiger-derived and leopard-derived DNA, and establishes the detection primer, the kit and the detection method of ordinary PCR detection to the tiger-derived and leopard-derived DNA. The sequence of the primer is SEQ ID NO.1 and SEQ ID NO.2; and based on the primer sequence, the invention discloses the ordinary PCR detection kit and the corresponding detection method for the tiger-derived and leopard-derived DNA comprising the primer. The primer of the invention has strong specificity, and the detection kit and the method are simple and convenient, and has accurate result and very high specificity and sensitivity.

Description

Technical field [0001] The invention relates to a method for detecting tiger and leopard genes. Especially the PCR detection method of tiger and leopard genes and the specific primers and related kits involved. Background technique [0002] Tigers and leopards are animals belonging to the genus Panthera of the cat family. The tiger is the largest cat in the world. There are 5 tiger subspecies in existence, including the Siberian tiger (Panthera tigris altaica), Sumatra tiger (Ptsumatrae), South China tiger (Ptamoyensis), and Indochinese tiger (Ptcorbetti). ) And Bengal Tiger (Pttigris). Currently, the number of wild tigers in China is very scarce. [0003] Leopards are the smallest among the four big cats of the genus Panthera (the remaining three are lion, tiger, and jaguar). Leopards are brightly colored, with many spots and golden fur, so they are also called leopards or leopards. [0004] In order to sustain the development of wildlife trade, various countries have formulate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 徐君怡曹际娟
Owner 徐君怡
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com