Genetic modification method for high-yield glutathione strain
A technology of glutathione and genetic transformation, applied in the direction of microorganism-based methods, biochemical equipment and methods, and the use of vectors to introduce foreign genetic materials, etc., can solve the problems that GSH cannot meet market demand and the GSH market has a large gap, and achieve Low cost, simple fermentation method, and the effect of reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0020] The concrete steps of the genetic transformation method of a kind of glutathione high-yield strain of the present invention are as follows:
[0021] Step 1: Amplify the target genes GSH1 and GSH2 from the S. cerevisiae INVSc1 genome template, and then load them into pGAPZA respectively to obtain recombinant plasmids pGAPZA-GSH1 and pGAPZA-GSH2:
[0022] 1. Amplify the target gene: GSH1
[0023] Template: S.cerevisiae INVSc1
[0024] Primers:
[0025] GSH1 upstream primer gsh1-1: GAAGCTCGAGACCATGGGACTCTTAGCTTTGGGCACGCC (added Kozak sequence) (XhoI)
[0026] GSH1 downstream primer gsh1-2: TCCTCGGGGCCCAATGGTCACGGCGTCTGGCTACG(ApaI)
[0027] PCR amplification reaction: DNA template 1 μl, 10×PCR buffer 2 μl, primer 2 μl, dNTP 5 μl, Taq DNA polymerase 0.5 μl, the total reaction volume is 20 μl, denaturation at 94°C for 5 minutes, 94°C for 45s, 58°C for 90s, 72°C 120s, 35 cycles. Amplified products were detected by 1.2% agarose gel electrophoresis. Fragment size: 2405bp. ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com