Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Spotted deer gamma-interferon double-antibody sandwich ELISA detection method, kit thereof and application of kit

A double-antibody sandwich, sika deer technology, applied in the fields of animal infectious diseases and microbial genetic engineering, can solve problems such as prolonging the culture time

Active Publication Date: 2010-07-28
HUAZHONG AGRI UNIV
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, if the culture time is extended, the detection will be mainly IFN-γ produced by memory T cells, which may lead to positive results in patients who have undergone treatment or the infection has cleared

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Spotted deer gamma-interferon double-antibody sandwich ELISA detection method, kit thereof and application of kit
  • Spotted deer gamma-interferon double-antibody sandwich ELISA detection method, kit thereof and application of kit
  • Spotted deer gamma-interferon double-antibody sandwich ELISA detection method, kit thereof and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Cloning of the target gene sika deer IFN-γ

[0043] 1. Source of plasmid and host bacteria

[0044] The pET-32a(+) plasmid vector used in this example was purchased from Novagen. Escherichia coli BL21 (DE3) competent cells were purchased from Hubei Wuhan Life Technology Co., Ltd.

[0045] 2. Primer design and synthesis

[0046] Prokaryotic expression primers were designed according to the sika deer IFN-γ cDNA sequence (GenBank accession No: X63079) published on GenBank. Primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0047] Prokaryotic expression primer sequences are as follows: Upstream primer: 5'ATAT GGATCC GATCTTATGGCCAGGGCCCA3' (the BamHI site is underlined); downstream primer: 5'TAAT AAGCTT TTACGTTGATGCTCTCCGGCCTCG3' (the underline is the HindIII site).

[0048] 3. PCR amplification of the target gene

[0049] Take sika deer jugular blood aseptically, anticoagulate with heparin, take 10mL whole blood of sika deer, add conca...

Embodiment 2

[0059] Example 2, construction of recombinant plasmid pET-32a-IFN-γ

[0060] 1. Ligation of vector plasmid pET-32a and IFN-γ PCR recovery product

[0061] The prokaryotic expression vector pET32a and the recovered IFN-γ PCR product were simultaneously double-digested by restriction enzymes BamH I and Hind III (purchased from Treasure Bioengineering (Dalian) Co., Ltd.), respectively, and the products were digested with 0.8% agarose Gel electrophoresis detection, gel recovery kit to purify the digested product. The purified digested products were ligated with T4 DNA Ligase (purchased from Fermentas), and ligated overnight in a water bath at 16°C, and then transformed into Escherichia coli DH5α competent cells.

[0062] 2. Conversion of Ligation Products

[0063] Take 100 μL of competent cell DH5α and add it to a sterilized 1.5mL EP tube, add 10 μL each of the ligated intermediate plasmid pET-32a-IFN-γ and mix well. After placing on ice for 30min, heat shock at 42°C for 90sec,...

Embodiment 3

[0077] Embodiment 3, expression and purification of target fusion gene in Escherichia coli

[0078] 1. Induced expression of the target gene

[0079] Inoculate the Escherichia coli strain DH5α containing the recombinant expression vector in 3 mL LB liquid medium containing 25 μg / mL kanamycin, and culture it on a shaker at 37°C until OD 600 Reach 0.6-0.8. Take 100 μL of the cultured bacterial liquid and inoculate it into 10 mL of fresh LB liquid medium containing 25 μg / mL kanamycin, culture it with shaking at 37°C for about 3 hours, until OD 600 When the concentration reaches 0.6-0.8, add isopropylthio-β-D-galactoside (IPTG, purchased from Invitrogen) to a final concentration of 0.8 mmol / L, continue culturing for 3 hours, and then collect the bacteria.

[0080] 2. SDS-PAGE electrophoresis analysis of expression products

[0081] 2.1 Preparation of SDS-PAGE electrophoresis samples

[0082] The induced recombinant Escherichia coli was centrifuged at 8000r / min for 15min. The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pore sizeaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of agricultural micrological gene-engineering and animal borne diseases, and relates to a spotted deer gamma-interferon double-antibody sandwich ELISA detection method, a kit thereof and application of the kit. A cell strain (CerIFN-gamma4C) capable of stably secreting a spotted deer gamma-interferon monoclonal antibody is obtained, and the storage number of the cell strain is CCTCC NO:C200966. The invention also establishes a spotted deer gamma-interferon double-sandwich ELISA detection method, which is characterized by establishing the spotted deer gamma-interferon monoclonal antibody, preparing a spotted deer gamma-interferon polyclonal antibody and the like. The kit of the invention comprises the spotted deer gamma-interferon monoclonal antibody, the spotted deer gamma-interferon polyclonal antibody, bovine tuberculosis specific three-gene fusion antigenic proteins RCE and other reagents. The invention also discloses the detection method and the application of the kit. The kit has the advantages of high specificity, high sensitivity, simple and convenient operations and quick diagnosis.

Description

technical field [0001] The invention relates to the technical field of microbial genetic engineering and the technical field of animal infectious diseases. It specifically relates to a detection method, kit and application of sika deer gamma-interferon. Background technique [0002] Deer tuberculosis (Cervus Tuberculosis, CTB) is a chronic zoonotic disease mainly caused by Mycobacterium bovis. The disease is easily contagious and can occur throughout the year. It is prevalent worldwide. It used to be one of the diseases that caused the largest number of deaths in humans and animals. It was designated as a B-type animal infectious disease by the World Organization for Animal Health (OIE), and China listed it as a disease. It is a second-class animal disease. There are three kinds of mycobacteria that mainly cause tuberculosis in humans and animals: Mycobacterium tuberculosis human, Mycobacterium bovis, and Mycobacterium avian. Tuberculosis etiology surveys at home and abro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577G01N33/543G01N33/535G01N21/78G01N1/28
Inventor 郭爱珍刘颖张广智廖娟红刘冬光于清龙王冰邹新峰熊家军杨利国陈焕春
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com