Scheme and application for increasing amylose content of corn seeds through overexpression of Sh2 and Bt2 genes and RNAi suppression expression of SBEIIa and SBEIIb genes
A technology of amylose content and high amylose starch is applied in the field of bioengineering breeding of crops, and can solve the problems of not significantly increasing starch content and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0045] Embodiment 1: Construction and selection of the RNAi structure of SBE IIa and SBE IIb genes
[0046] 1) Cloning of SBE IIa and SBE IIb gene fragments
[0047] The specific and conserved regions of corn starch branching enzyme genes SBE IIa and IIb were amplified by PCR method. According to the sequences of SBE IIa and IIb genes, primers for amplifying the specific regions and conserved regions of SBE IIa and IIb were designed. The primers used to amplify the specific fragment of the SBE IIb gene are: Special 5': 5'CGGTCGCTGGGGTTTTAG 3', and Special 3': 5'GAGCCGAGTCAGCCCTTG 3', each with a protective base at the 5' end of the primer The restriction endonuclease sites BamHI and NcoI. The primers used to amplify the specific fragment of SBE IIa gene are: special 5' long: 5'ACTTGCCGTCGGTGCTCT 3', and special 3' long: 5'CCAACATTGGGTCAATCTCAT 3'; special 5' short: 5'ATGACTTGCTTTCCTCCG 3', and special 3' 'Short: 5'TCCTCAGCCTCAACTCCT 3'; a restriction endonuclease site XhoI ...
Embodiment 2
[0057] Example 2: Construction of multigene (RNAi structure) transformation vector and creation of high-amylose high-yielding maize
[0058] 1) Cloning of large and small subunit genes Sh2 and Bt2 of maize endosperm AGPase
[0059] According to the nucleotide sequences of the large and small subunit genes Sh2 and Bt2 of maize endosperm-specific AGPase, using the constructed endosperm cDNA library, primers were designed and the full-length cDNA of the gene was amplified by PCR. The primer sequence used to amplify the full-length sequence of the Sh2 coding region is: 5' end primer 5' GCTCTAGAGC TCGGGAGGCAAGTGCGA TTT 3’, 3’ Primer 5’ GCTCTAGAGC GTCAAGCGGCTCTTACCATACCAA 3', the restriction endonuclease site XbaI (underlined) with protective bases is added at the 5' end of the primer. Sh2 full-length amplification was performed by gradient PCR with Pyrobest Taq enzyme, and the reaction conditions were: 95°C 5min; 95°C 1min, 57°C 1min (±4°C), 72°C 2min, 35 cycles; 72°C 7min. The ...
Embodiment 3
[0068] Example 3: Transformation of maize clustered bud tissue blocks to create high-amylose high-yield inbred lines and its application
[0069] 1) The establishment of the receptor system is based on the backbone inbred lines used in agricultural production in my country, such as the inbred seeds of Zheng 58, Ye 478, and Ye 515. Clustered buds were induced from the shoot tips in vitro, and the clustered buds were used as receptors for genetic transformation. The media used are:
[0070] Seed germination medium: KNO 3 1900mg / l, NH4NO 3 1650mg / l, CaCl 2 2H 2 O 440mg / l, MgSO 4 ·7H 2 O 370mg / l, KH 2 PO 4 ·H 2 O 170mg / l, FeSO 4 ·7H 2 O 27.8mg / l, ZnSO 4 ·7H 2 O 10mg / l, MnSO 4 4H 2 O 22.3 mg / l, H 3 BO 3 10mg / l, KI 0.83mg / l, Na 2 MoO 4 2H 2 O 0.5mg / l, CuSO 4 ·5H 2 O 0.025mg / l, CoCl 2 ·6H 2 O 0.025mg / l, Thiamine Hydrochloride 10.0mg / l, Pyridoxine Hydrochloride 1.0mg / l, Niacin 1.0mg / l, Glycine 2.0mg / l, Inositol 100.0mg / l, Biotin 0.05mg / l , casein hydrolyzat...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com