Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Liquid-phase chip for detecting flu and H5N1 avian influenza virus and specific detection primer and preparation method thereof

A bird flu virus, liquid phase chip technology, applied in the field of medical detection, to achieve the effect of detecting many types of viruses

Inactive Publication Date: 2011-08-31
JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method can only quickly detect H5N1 subtypes, and cannot simultaneously detect H1N1, H3N2 and other influenza A viruses and influenza B viruses at the same time, and requires two rounds of PCR reactions, which takes a long time to detect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Liquid-phase chip for detecting flu and H5N1 avian influenza virus and specific detection primer and preparation method thereof
  • Liquid-phase chip for detecting flu and H5N1 avian influenza virus and specific detection primer and preparation method thereof
  • Liquid-phase chip for detecting flu and H5N1 avian influenza virus and specific detection primer and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038]The first step: design primers and probes, use bioinformatics knowledge and bioinformatics software to pass through the gene segment sequences of all influenza A viruses H5, N1 and NP in the nucleic acid database and the HA gene segment sequences in influenza B viruses The computer performs homology comparison, and designs degenerate primers and specific probes for each gene according to the conserved sequence; the obtained degenerate primers are as follows:

[0039] FluA-Reverse GGTCTTGTCTTTAGCCAYTCCAT

[0040] H5-Forward GGTAACGGTTGTTTCGARTTCTATCA

[0041] H5-Reverse ATAGACCAGCYACCATGATTGCCAG

[0042] N1-Forward GGACYAGTGGGAGCAGCATA

[0043] N1-Reverse TGTCAATGGTRAAYGGCAACTC

[0044] FluB-Forward AAATACGGTGGATTAAATAAAAGCAA

[0045] FluB-Reverse CCAGCAATAGCTCCGAAGAAA;

[0046] The resulting specific probes are as follows:

[0047] FluA-probe TCAGGCCCCCTCAAAGCCGA

[0048] H5-probe CCGCAGTATTCAGAAGAAGC

[0049] N1-probe TGGTCTTGGCCAGACGGTGC

[0050] FluB-probe GC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting influenza viruses, in particular to a method for detecting influenza viruses and H5N1 subtype avian influenza virus by a liquid-phase chip, belonging to the technical field of medical monitoring. The method is a fast and highly efficient one which can identify FluA and FluB influenza viruses including the H5N1 subtype avian influenza virus by types.With the utilization of a liquid-phase chip technology and the application of bioinformatics knowledge and related bioinformatics software, the liquid-phase chip which can specifically distinguish H5and N1 gene fragments, NP gene fragment of the FluA influenza virus and HA gene fragment of the FluB influenza virus is manufactured. The method has the advantages that fast detecting and early-stagediagnosis of the FluA and the FluB influenza viruses including the H5N1 subtype highly pathogenic avian influenza virus can be carried out; and a basis for developing other fast and highly effective detecting methods for detecting various subtype influenza viruses is provided. The method is characterized by detecting multiple types of viruses, short response time and high sensitivity, thus determining that the method has wide application prospect.

Description

technical field [0001] The invention relates to a liquid phase chip for detecting viruses, a specific detection primer and a preparation method thereof, in particular to a liquid phase chip for detecting influenza and H5N1 subtype avian influenza virus, a specific detection primer and a preparation method thereof, belonging to The field of medical testing technology. Background technique [0002] So far, it has been found that the subtypes of avian influenza viruses that can directly infect humans include H5N1, H7N1, H7N2, H7N3, H7N7 and H9N2, among which the H5N1 subtype poses the greatest threat to humans. In addition, the main influenza viruses that threaten humans include H1N1, H3N2 and other influenza A viruses and influenza B viruses. [0003] At present, the main detection methods of avian influenza virus include three aspects: virus isolation, virus antigen and gene detection, and serological examination. Among them, virus isolation takes a long time and requires ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 崔仑标葛以跃史智扬曾晓燕焦永军潘浩汪华
Owner JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com