Test paper strip for detecting swine chain coccus type 2 antibody colloidal gold, method for making same and applications
A technology of streptococcus suis and detection test paper, which is applied in measurement devices, instruments, scientific instruments, etc., can solve the problems of requiring professionals, complicated operation, expensive instruments, etc., and achieves the effect of easy promotion, simple operation, and clear and easy to distinguish results.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Cloning expression of embodiment 1 Streptococcus suis type 2 specific antigen MRP
[0039] (1) Amplification of MRP gene
[0040] PCR primer design
[0041] According to the fragment to be amplified, a pair of primers were designed, and Sac I and Hind III restriction sites and protective bases were added to the two ends of the primers respectively. Primers P1 and P2 can amplify the open reading frame of Streptococcus suis type 2 MRP gene ( ORF) 529bp fragment between 298~827bp. (MRP gene GenBank accession number is EF520110)
[0042] The primer sequences are:
[0043] Upstream primer P1: 5′2GTAGAGCTCGAACAGGTAACATCAGA3′;
[0044]Downstream primer P2: 5'2CAGAAGCTTAAGAGTAACGAATGTAGG3'.
[0045] PCR amplification
[0046] Each reactant was sequentially added in the following order and conditions and PCR amplification was performed. Template DNA 2μL, 10×buffer 10μL, 25mmol / L MgCl 2 8 μL, 215 mmol / L dNTPs 8 μL, primers P1 and P2 (0.1 μmol / L) each 1 μL, ddH 2 O 68 μL...
Embodiment 2
[0056] Embodiment 2: the development of anti-Streptococcus suis type 2 MRP protein monoclonal antibody cell line
[0057] (1) Immunized mice
[0058] The prepared genetically engineered antigen was used to immunize BALB / C mice with a certain dose. The immune effect was detected by ELISA method.
[0059] (2) Myeloma cells
[0060] SP2 / 0 myeloma cells: resuscitate SP2 / 0 cells stored in a liquid nitrogen tank, and culture them in DMEM medium containing 10% calf serum for 48-72 hours, until the cells grow well, the cells are round, transparent, and uniform in size , neatly arranged, logarithmically split, and ready for fusion.
[0061] (3) cell fusion
[0062] Prepared SP2 / 0 cells and splenic lymphocytes of immunized BALB / C mice were prepared in 2×10 7 / ml and 1×10 8 / ml. Take 1ml of each and mix at room temperature. 0.8 ml of 50% PEG (molecular weight 1500) was used as fusion agent; 10% calf serum DMEM was used as culture medium.
[0063] (4) Detection and screening of p...
Embodiment 3
[0070] Embodiment 3: the detection of anti-Streptococcus suis type 2 MRP monoclonal antibody
[0071] (1) Monoclonal antibody ascites preparation:
[0072] Mice: SPF grade mice, no rodent virus contamination after inspection, if the animals are found to be unhealthy, bitten or infected during the ascites production process, they should be discarded.
[0073] Expanded culture of cell lines: Take one tube of the production batch of cells to resuscitate, add nutrient solution to expand the culture, one tube of production cells is only used once, and will not be frozen.
[0074] Inoculation of hybridoma cell lines: preparation of ascites should be carried out under sterile conditions, before injection of hybridoma cells, each mouse was intraperitoneally injected with liquid paraffin 0.5ml. One week later, each mouse was intraperitoneally injected with 1-3×10 hybridoma cells. 6 / 0.2ml.
[0075] Ascites collection: 7 to 10 days after injecting the cell line, or the ascites was co...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com