Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

RT-PCR method for testing hantavirus genome

An RT-PCR, Hantavirus technology, applied in the field of Hantavirus genome detection, to achieve the effect of high positive detection rate, increased genus specificity, and high detection rate

Inactive Publication Date: 2010-09-01
WUHAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research report on the general primer of this new type of hantavirus at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RT-PCR method for testing hantavirus genome
  • RT-PCR method for testing hantavirus genome
  • RT-PCR method for testing hantavirus genome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: RT-PCR method detects the genomic RNA of HV positive template

[0029] A. Synthesize two pairs of universal primers for the novel hantavirus, and hand them over to Shanghai Sangong Co., Ltd.:

[0030] a. The upstream primer of HV P1 / P2 is GATTGAAGATATTGAGTCACC,

[0031] The downstream primer is GTTGTATCCCCATTGATTGTG;

[0032] b. The upstream primer of HV P3 / P4 is TGAGAAATGTGTATGACATGA,

[0033] The downstream primer is ACTAGACACTGTTTCAAATGA.

[0034] B. Hantavirus genome detection method:

[0035] 1. Preparation of positive template

[0036] After Vero E6 cells were routinely cultured into a single layer, 100TCID were inoculated 50 1ml each of the HV 76-118 and HV 114 strain viruses, adsorbed for 2 hours, the culture solution was replaced with a maintenance solution containing 2% fetal bovine serum, and the culture was continued at 37°C in a CO2 incubator. After 14 days, a small number of cells were scraped for HV-specific immun...

Embodiment 2

[0047] Embodiment 2: RT-PCR method detects HV RNA in the old serum sample

[0048] RT-PCR detection of 432 HV serum samples from 1985-1989 and 1996-2007. Because the level of viral nucleic acid in serum is low, and RNA is easily degraded, the detection rate of viral RNA in old serum is usually extremely low. In this study, each extracted nucleic acid sample was amplified in parallel by using new HV primers (HV P1 / P2 and HV P3 / P4).

[0049] 1. RNA extraction

[0050] Take 200 μl of serum, and use a total RNA extraction kit (promega company product) to extract serum total RNA according to the kit instructions.

[0051] 2. Determination of the purity and concentration of RNA

[0052] Measure the optical density values ​​OD260 and OD280 of RNA samples at 260nm and 280nm wavelengths respectively, and determine the RNA purity by calculating OD260 / OD280. The results show that all RNA samples OD260 / OD280≥1.9, indicating that the RNA is of high purity and free from DNA and protein c...

Embodiment 3

[0060] Embodiment 3: RT-PCR method is used for epidemiological detection HV RNA in mouse lung tissue

[0061] In 2002, 204 rat tissue specimens were collected from four counties of Jiangxia, Nanzhang, Qichun and Xinzhou in Hubei for RT-PCR testing. In this study, each extracted nucleic acid sample was amplified in parallel by using new HV primers (HV P1 / P2 and HV P3 / P4), and those with specific bands were positive for HV infection.

[0062] 1. RNA extraction

[0063] The rats were sacrificed by cervical dislocation after ether anesthesia, and about 20-30 mg of lung tissue was taken from the rats. After homogenization, total RNA was extracted with a total RNA extraction kit (promega company product) according to the kit instructions.

[0064] 2. Determination of the purity and concentration of RNA

[0065] Measure the optical density values ​​OD260 and OD280 of RNA samples at 260nm and 280nm wavelengths respectively, and determine the RNA purity by calculating OD260 / OD280. Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting hantaan virus strain genome. The method has the following steps: (1) two pairs of hantaan virus general primers are designed; (2) the hantaan virus detection method comprises the following steps that: first, viral specific RNA extraction kit is utilized to extract the total RNA in a serum sample; second, a nucleic acid analyzer is adopted to detect the RNA content, and the RNA is taken to perform the RT-PCR reaction; third, RT-PCR:RT uses HV group-specific primers such as P0, PCR uses HV general primers such as P1P2 and P3P4; fourth, viral nucleic acid amplified results are observed through agarose gel electrophoresis, and a specific nucleic acid band appears. The method is intuitionistic and predominant, the sensibility is good, and the effects are good; the serum detection rate in recent ten years is 79.2 percent, and the serum detection rate in twenty years ago can still reach to 70.5 percent; the method is applied to the laboratory detection of hantaan virus infection and the molecular epidemiological survey.

Description

technical field [0001] The present invention relates to the field of virus detection, in particular to a method for detecting the hantavirus (HV) genome, comprising designing two pairs of general primers for the novel hantavirus, studying experimental conditions, and establishing a RT-PCR method for the virus genome, Serum samples of Hantavirus in different ages were tested. Background technique [0002] Viral diseases are a class of infectious diseases that seriously threaten human health. More than 85% of infectious diseases are caused by viruses, and important viruses endanger national security and social development. Hantaviruses (HV) are the pathogens of hemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary syndrome (HPS). It is listed by the World Health Organization as a biological weapon that can be transmitted through aerosols. The main features of HFRS / HPS are fever, hemorrhagic renal impairment, and respiratory failure. my country is the country...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 杨占秋李晴陈文刘婧肖红付萍
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com