Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Alpha-amylase

a technology of alpha-amylase and amylase, which is applied in the field of alpha-amylase, can solve the problems of granule splitting, affecting the volume, texture and appearance of loaf, and affecting the quality of loaf,

Inactive Publication Date: 2014-12-25
DSM IP ASSETS BV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0027](f) an amino acid sequence having at least 70% identity to an amino acid sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and having at least one of Asp at position 184, Ala at position 297, Thr at position 368 and Asn at position 489, said positions being defined with reference to SEQ ID NO: 2 and said amino acid sequence characterized in that when used to prepare a baked product having a least 5 wt % sugar based on flour, said baked product has reduced hardness after storage in comparison with a baked product prepared without use of said amino acid sequence.

Problems solved by technology

This means that if this enzyme is not used in sufficient amount, the volume, texture, and appearance of the loaf are substantially impaired.
A proportion of these granules from hard-milling wheat varieties become “damaged”, with granules splitting apart as a consequence of the energy of milling.
The low heat stability of the enzyme means that the enzyme is inactivated during baking and, critically before starch gelatinisation has taken place, such that there is little or no breakdown of the starch from the undamaged fraction.
As a consequence, fungal amylase is useful in providing sugars for fermentation and color, but has practically no value in extending shelf-life.
However, while bacterial alpha-amylase can be useful with regard to shelf-life extension, it is difficult to use practically as small over-doses lead to an unacceptable crumb structure of large and open pores, while the texture can become too soft and “gummy”.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-amylase
  • Alpha-amylase
  • Alpha-amylase

Examples

Experimental program
Comparison scheme
Effect test

example 1

Production of the Alpha-Amylase of the Invention

Cloning and Enzyme Preparation

[0394]As described in further detail below the alpha-amylase gene was cloned and expressed in B. subtilis in the following way

Strains and Plasmids

[0395]Bacillus subtilis strain BS154 (CBS 363.94) (ΔaprE, ΔnprE, amyE-, spo-) is described in Quax and Broekhuizen 1994 Appl Microbiol Biotechnol. 41: 425-431.

[0396]The E. coli / B. subtilis shuttle vector pBHA12 is described in (WO2008 / 000632). Alicyclobacillus pohliae NCIMB14276 was described by Imperio et al (Int. J. Syst. Evol. Microbiol 58:221-225, 2008).

[0397]Bacillus stearothermophilus C599 (NCIMB11873) is described in WO91 / 04669.

Molecular Biology Techniques

[0398]Molecular biology techniques known to the skilled person were performed (see: Sambrook & Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., CSHL Press, Cold Spring Harbor, N.Y., 2001). Polymerase chain reaction (PCR) was performed on a thermocycler with Phusion High-Fidelity DNA polymerase (F...

example 2

Expression of A. pohliae DSM-AM Gene in Bacillus subtilis

[0403]An amyQ terminator and a PmeI restriction site were introduced in the pBHA12 vector by digesting pBHA12 with SphI and HindIII and cloning the following DNA sequence 5′-GCATGCGTTTAAACAAAAACACCTCCAAGCTGAGTGCGGGTATCAGCTTGGAGGTGC GTTTATTTTTTCAGCCGTATGACAAGGTCGGCATCAGAAGCTT-3′ (the 5′SphI and 3′HindIII restriction sites are underlined).

[0404]The fragment was cloned into pBHA12 which resulted in vector pGBB09 (FIG. 1).

[0405]The DSM-AM gene was synthesised by GeneArt (Germany) and at the 5′ end the PacI restriction site was added and at its 3′end the PmeI restriction site was added. The DSM-AM gene was cloned into the Pad and PmeI digested pGBB09 vector which resulted in vector pGBB09DSM-AM1 (FIG. 2). This vector was transformed to B. subtilis strain BS154. The sequence of the plasmid was confirmed by DNA sequencing. The B. subtilis strain BS154 containing pGBB09DSM-AM1 was named DSM-AMB154-1.

example 3

Expression of DSM-AM with B. subtilis in Shake Flasks

[0406]B. subtilis strains DSM-AMB154-1 and BS154 were grown in a shake flask. These shake flasks contained 20 ml 2×TY medium composed of 1.6% (w / v) Bacto tryptone, 1% (w / v) Yeast extract and 0.5% (w / v) NaCl. The cultures were shaken vigorously at 37° C. and 250 rpm for 16 hours and 0.2 ml culture medium was used to inoculate 20 ml SMM medium. SMM pre-medium contains 1.25% (w / w) yeast extract, 0.05% (w / w) CaCl2, 0.075% (w / w) MgCl2.6H2O, 15 μg / l MnSO4.4H2O, 10 μg / l CoCl2.6H2O, 0.05% (w / w) citric acid, 0.025% (w / w) antifoam 86 / 013 (Basildon Chemicals, Abingdon, UK). To complete SMM medium, 20 ml of 5% (w / v) maltose and 20 ml of a 200 mM Na-phosphate buffer stock solution (pH 6.8), both prepared and sterilized separately, were added to 60 ml SMM pre-medium. These cultures were incubated for 48 hours at 37° C. and 250 rpm. The supernatants were harvested and analysed for enzyme productivity. The alpha-amylase activity of strain DSM-AMB...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperaturesaaaaaaaaaa
temperaturesaaaaaaaaaa
temperaturesaaaaaaaaaa
Login to View More

Abstract

This invention relates to a novel alpha-amylase, a process for its preparation and the use of the amylase.The invention relates to a newly identified polynucleotide sequence from Alicyclobacillus pohliae comprising a gene that encodes the novel alpha-amylase enzyme. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional protein of the gene. The invention also relates to methods of using these proteins in industrial processes, for example in food industry, such as the baking industry. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins and cells.

Description

FIELD OF INVENTION[0001]This invention involves a novel alpha-amylase, a process for its preparation and the use of the amylase.[0002]The invention relates to a newly identified polynucleotide sequence comprising a gene that encodes the novel alpha-amylase enzyme. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional protein of the gene. The invention also relates to methods of using these proteins in industrial processes, for example in food industry, such as the baking industry. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins and cells. The invention relates to a method of manufacturing the polynucleotide according to the invention. The invention further relates to a method for manufacturing the polypeptide according to the invention.BACKGROUND OF THE INVENTION[0003]Studies on bread staling have indicated th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N9/28A21D13/06A21D8/04
CPCC12N9/2417A21D13/06A21D8/042C12Y302/01001C12N15/00
Inventor PARENICOVA, LUCIE
Owner DSM IP ASSETS BV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com