Self-assembly composite nano granule tumor vaccine and method for preparing same
A composite nanoparticle and tumor vaccine technology is applied in the field of self-assembled composite nanoparticle tumor vaccine and its preparation, so as to achieve the effect of attacking and inhibiting and stimulating the body's immune system.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1. Construction and Identification of Universal Tumor Vaccine Expression Vector pCI-pr-GPI
[0035] 1. Determine the general sequence
[0036] According to the technical scheme, the order of the general sequence is 5'-NheI-EcoRV-G-G-G-protamine gene-IgG Fc-GPI-Not-3'. Immunomodulatory molecule genes are inserted between NheI-EcoRV enzyme cutting sites, and the connecting arm composed of 3 Gs makes the expressed molecules have a certain degree of spatial freedom, which is easy to maintain their natural activity. The gene of the entire universal sequence has a total of 1472bp, and the sequence is as follows:
[0037] GCGGCTAGC(NheI)GATATC(EcoRV)GGAGGGGGA CGCTCCCAGTCCCGGAGCAGATACTACAGGCAGCGCCAGAGAAGCCGGAGGCGCAGAAGAAGGTCC GTTGGTGAGAGCTCAGCGCTCCTGCCTGGACGCATCCCGGCTATGCAGCCCCAGTCCAGGGCAGCAAGGCAGGCCCCGTCTGCCTCTTCACCCGGAGGCCTCTGCCCGCCCCACTCATGCTCAGGGAGAGGGTCTTCTGGCTTTTTCCCCAGGCTCTGGGCAGGCACAGGCTAGGTGCCCCTAACCCAGGCCCTGCACACAAAGGGGCAGGTGCTGGGCTCAGACCTGCCAAGAGCCATAT...
Embodiment 2
[0048]Example 2. Obtaining a tumor cell line that anchors and expresses related molecular elements (taking GM-CSF / Renca as an example)
[0049] 1. Acquisition of GM-CSF gene
[0050] Primers were designed according to the GM-CSF gene sequence on the gene bank, and Shanghai Sangon Bioengineering Co., Ltd. was commissioned to synthesize F1: GCGCTAGCAGCCTCTCAGCACCCACCCGCTCACC, R1: GC GATATCTTTTTGGACTGGTTTTTTGC.
[0051] Mouse PBMC cells were extracted and induced with 5ug / ml ConA for 4 hours, and total RNA was extracted for RT-PCR. For specific methods, see the Introgene Trozol kit instructions. After PCR amplification, a band appeared at the molecular weight of 400bp, which was sequenced as GM-CSF gene.
[0052] 2. Acquisition of pCI-pr-GPI / GM-CSF recombinant plasmid
[0053] After PCR amplification, the product was purified and the plasmid pCI-pr-GPI was digested with NheI and EcoRV respectively, and then the digested gene was connected to the plasmid, and after transformatio...
Embodiment 3
[0057] Embodiment three, self-assembled composite nanoparticle vaccine
[0058] 1. Obtain the cell membrane anchored and expressed by various related molecular elements
[0059] A total of 10 Renca cells modified with various related molecular elements were collected 8 For each, lyse the cells with hypotonic buffer (25mmol / L Tris-HCl.PH7.4) containing protease inhibitors, aspirate more than 3 times with a 27 gauge needle (4.5 gauge), mix well and centrifuge at 2,300rpm (2,000g) for 10min , take the supernatant (containing membrane components). Centrifuge at 25,400rpm (22,000g) for 30min to collect the precipitate.
[0060] 2. Formation of composite nanoparticle vaccine
[0061] Wash twice with solution I (0.15mol / L NaCl, 10mmol / L Tris, pH8.0), wash with solution II (0.14mol / L NaCl, 25mmol / L Tris-HCl, pH7.4, which contains 2% 1- S-Octyl Beta-D-thioglucopyranoside) dissolved to a concentration of 10 8 cells / mL, shake at 4°C for 30 min. Take the supernatant by centrifugatio...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com