Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Polynucleotide for inducing apoptosis and its coded polypeptide and use

A technology of polynucleotides and induced cells, which is applied in the fields of peptides, peptide antibodies, autoimmune diseases and tumor drugs, and can solve the problems of lymphocyte autoimmune diseases and immune active cell clearance obstacles, etc.

Inactive Publication Date: 2007-01-24
SINOGENOMAX
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, if this mechanism is obstructed, then the clearance of immunocompetent cells that recognize self-antigens will be obstructed, resulting in lymphocyte proliferative autoimmune diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polynucleotide for inducing apoptosis and its coded polypeptide and use
  • Polynucleotide for inducing apoptosis and its coded polypeptide and use
  • Polynucleotide for inducing apoptosis and its coded polypeptide and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Embodiment 1, two-step method flux quantification RT-PCR technique amplifies target gene

[0088] gene name

Upstream primer (5'-3')

Downstream primer (5'-3')

NIAG1

NIAG2

NIAG3

NIAG4

NIAG5

NIAG6

NIAG7

NIAG8

NIAG9

NIAG10

NIAG11

NIAG12

NIAG13

gtcgacgctgcttcgttg

tgtcgtgaggctgaggtgcag

cctcggttaaacactggtcgttc

tgtgtccgtcgccatgacag

acttcatcgtcatgcagagcgtc

ggaggtcgctgctatgatccg

cctcggttaaacactggtcgttc

tgtcccatgaggctgccc

cattgatgcacccattccagtg

atgccaggtcgttggaggt

gggtggccgaagcagaagac

gcaaccatcaatcccgtctcc

ctgagggaacgctaagtagtgtgtc

gcctcctggagtgtggtggtc

gtgaaacgtggttagtctcgtaaaatg

ttctgtcactcttactaggattcgcc

tggttgagtggcaggtgagg

ccgtcactccgtgtgcgc

gccttactggatcacacacagtttc

ttctgtcactcttactaggattcgcc

tccctaatagtagcgattcaggctc

tctccaggtctcggtgtagcg

gaggggggagctacaactcg

ggcagactctcaagatatt...

Embodiment 2

[0100] Embodiment 2, the construction of target gene eukaryotic expression vector

[0101] The purified product of secondary amplification and the eukaryotic expression vector pcDNA3.1 / V5-His-TOPO (Invitrogen, abbreviated as pcDT) were ligated according to the conditions suggested by the kit manufacturer. The ligation product was transformed into Escherichia coli DH5α by electric shock method, and the transformant was grown on a solid LB plate medium containing ampicillin, and the grown single clone colony was selected, the plasmid was extracted, digested with EcoRI, and the digested product was identified by agarose gel electrophoresis. Select positive clones with inserts, select the correct forward insert clones by sequencing (ABI PRISM 3700 DNA analyzer), and name them NIAG1, 2, 3, 4, 5, 6, 7, 8, 9, 10, respectively. 11, 12, 13.

[0102] At the same time, the culture fluid was collected, and the precipitated protein was analyzed by SDS-PAGE to obtain NIAG1, 2, 3, 4, 5, 6, ...

Embodiment 3

[0104] Example 3, Renilla luciferase reporter gene method to determine the effect of the target gene on inducing apoptosis

[0105] Co-transfect human embryonic kidney 293T cells with the target gene and pRL family Renilla luciferase reporter gene carrier, and detect the effect of the target gene on the cell state by detecting the activity of Renilla luciferase, such as cell number, cell survival rate, etc. . The genes whose Renilla luciferase activity was significantly reduced compared with the pcDT empty plasmid were screened out. The specific operation steps are as follows:

[0106] (1) Cell culture: 1.2×10 4293T cells (ATCC Number: CRL-11268) were plated on a 96-well cell culture plate (Costar, 3599) with DMEM (Dulbecco's modified Eagle's medium) medium (Hyclone, SH0022.02) containing 10% fetal bovine serum (100 μl medium / well), in 5% CO 2 , cultured in a cell culture incubator (SANYO, MCO-15AC) at 37°C for 24 hours.

[0107] (2) Prepare transfection working solution:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a new kind of polynucleotide coding human protein with apoptosis inducing function, its coded polypeptide and the antibody to the polypeptide. The present invention also discloses the application of the new polynucleotides in extraneously expressing in host cell to induce apoptosis. The present invention also discloses the application of the polypeptide and antibody in preparing medicine for preventing and treating human body's apoptosis relevant diseases, especially in developing medicine for AIDS, neural retrograde affection and other autoimmunie diseases and tumors.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the field of gene expression regulation. Specifically, the invention relates to a new class of polynucleotide encoding a human protein with the function of inducing apoptosis, its encoded polypeptide, and an antibody to the polypeptide. The present invention also relates to the application of exogenous expression of this novel polynucleotide in host cells to induce cell apoptosis. The present invention also relates to the use of the polypeptide and antibody in the preparation of prevention and treatment of diseases related to human cell apoptosis, especially in the development of drugs for autoimmune diseases and tumors such as AIDS and degenerative diseases of the nervous system. Background technique [0002] Cells in the human body are doomed to die, some death is physiological, and some death is pathological. The research on the process of cell death has become a hot spot in biology ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/63C07K16/18A61K38/17A61P35/00A61P37/00C12Q1/68G01N33/53
Inventor 石太平王兰马大龙高霞高鹏于传飞邓唯唯郭金海马进京程华玲王欣宇童郁蓉
Owner SINOGENOMAX
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com