Plant expression vector of gene CmMYB15-like for improving aphid resistance of chrysanthemum and application of plant expression vector
A pmdc43-cmmyb15-like, plant expression vector technology, applied in the field of plant expression vectors and their construction, can solve the problems of excavation and utilization of excellent aphid resistance genes, aphid drug resistance, etc., to improve aphid resistance, Excellent resistance to aphids and the effect of increasing cell wall thickness
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1: Obtaining the CmMYB15-like gene that directly regulates the lignin synthesis gene Cm4CL2 The AC-I (ACCTACC) and AC-II (ACCAACC) cis-acting elements that regulate lignin synthesis in the promoter region of Cm4CL2 were constructed by repeating them in tandem. To pHIS2 vector, it was used as 'bait' to screen chrysanthemum yeast one-hybrid library to obtain annotated gene encoding MYB protein CmMYB15-like ( figure 1 ).
Embodiment 2
[0060] Example 2: Cloning of Chrysanthemum CmMYB15-like gene
[0061] Take chrysanthemum 'Shenma' leaves as material, take 0.2 g of leaves, extract total RNA from leaves according to the operation method of the RNA extraction kit (Hua Yue Yang), and perform reverse transcription according to the instructions of the reverse transcription kit (TaKaRa) to obtain cDNA , according to the sequence information of the CmMYB15-like gene in the chrysanthemum library, use the primer5 software to design specific primers to amplify CmMYB15-like;
[0062] Upstream primer CmMYB15-like-F: ATGGGGAGAGCACCTTGTTG (SEQ ID NO: 5);
[0063] Downstream primer CmMYB15-like-R: TTAAAACTCAGGTAACTCGG (SEQ ID NO: 6).
[0064] The reverse transcribed leaf cDNA was used as a template for PCR reaction, 50 μL reaction system: 5×Phusion HFbuffer 10.0 μL, CmMYB15-like-F (10 μM), CmMYB15-like-R (10 μM) primers 2.5 μL (10 μM) each, dNTP (2.5mM) 4.0μL, Phusion DNA Polymerase 0.5μL, cDNA template 1μL, ddH 2 O 29....
Embodiment 3
[0065] Example 3: Construction of plant expression vector pMDC43-CmMYB15-like
[0066] The construction process of plant expression vector pMDC43-CmMYB15-like is as follows image 3 As shown, according to the CmMYB15-like gene sequence, BamH I and Xho I restriction sites were introduced upstream and downstream, respectively, and primers CmMYB15-like-GATE-F and CmMYB15-like-GATE-R were designed:
[0067] CmMYB15-like-GATE-F: CGGGATCCGGATGGGGAGAGCACCT (SEQ ID NO: 7);
[0068] CmMYB15-like-GATE-R: CCGCTCGAGTGAAACTCAGGTAACTC (SEQ ID NO: 8).
[0069] Use the pMD19-T-CmMYB15-like plasmid containing the CmMYB15-like gene sequence as a template to carry out PCR reaction, 50 μL reaction system: 5×Phusion HF buffer 10.0 μL, CmMYB15-like-GATE-F (10 μM), CmMYB15-like- GATE-R (10μM) primer 2.5μL each (10μM), dNTP (2.5mM) 4.0μL, Phusion DNAPolymerase 0.5μL, pMD19-T-CmMYB15-like plasmid template 1μL, ddH 2 O 29.5 μL; reaction program: pre-denaturation at 98°C for 30sec; 98°C for 10sec, 58...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap