Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Molecular marker SSR primer for identifying genetic relationship and variety of rehmannia glutinosa variety, kit and application

A genetic relationship and molecular marker technology, which is applied in the field of molecular marker SSR primers for species identification, and the genetic relationship of Rehmannia glutinosa varieties, can solve the problems of inability to construct variety fingerprints, failure to achieve specific identification of a single variety, etc. Increased stability and good repeatability

Pending Publication Date: 2022-07-05
HENAN ACAD OF SCI INST OF BIOLOGY LIABILITY +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The above studies are limited by the types, quantities and detection techniques of markers, and the analysis results are basically limited to the evaluation and clustering of genetic diversity of varieties or populations, and the specific identification of individual varieties has not been realized, and the fingerprints of varieties cannot be constructed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker SSR primer for identifying genetic relationship and variety of rehmannia glutinosa variety, kit and application
  • Molecular marker SSR primer for identifying genetic relationship and variety of rehmannia glutinosa variety, kit and application
  • Molecular marker SSR primer for identifying genetic relationship and variety of rehmannia glutinosa variety, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] This example provides 50 pairs of SSR primers, whose sequences are as shown in SEQ ID NO. 1-100.

Embodiment 2

[0029] Example 2 PCR reaction

[0030] 2.1 Sample collection and DNA extraction

[0031]For each of the above 17 cultivars, 3 Rehmannia glutinosa plants with the same growth and size were selected, and 3 to 5 pieces of young leaves from each plant were temporarily stored on dry ice. Total DNA was extracted by CTAB method, and DNA was determined by 0.8% agarose electrophoresis and microspectrophotometer. All samples were diluted to 50ng / μL and stored at -20°C for later use;

[0032] 2.2 Preparation of synthetic TP-M13-SSR primers

[0033] Synthesize the 50 pairs of SSR primer sequences provided in Example 1 above, and connect the 5 ends of the upstream primers of all primer pairs to the M13 sequence (ACACGACGTTGTAAAACGAC) to form 50 pairs of TP-M13 primers. The primers were diluted to 1pm / μL (upstream) and 10pm / μL (downstream) for use; FAM, PET, VIC and NED fluorophores were introduced into the M13 sequence to provide four fluorescent primers, which were diluted to 10pm / μL fo...

Embodiment 3

[0041] Example 3 PCR product analysis and data processing

[0042] 3.1 Electrophoresis detection

[0043] Firstly, the PCR products corresponding to each variety obtained in Example 2 were subjected to electrophoresis detection. The specific steps included: after the PCR products labeled with FAM, PET, VIC and NED fluorescence were evenly mixed in a ratio of 2:4:2:2, from Pipet 1 μL of the mixture and add it to the wells of the deep-well plate dedicated to the DNA analyzer. Add 0.1 μL of LIZ500 molecular weight internal standard and 8.9 μL of deionized formamide to each well of the plate; denature the samples at 95 °C for 5 min on the PCR instrument, and take them out. , immediately placed on crushed ice, cooled for more than 10 min, centrifuged briefly for 10 s, and placed on a DNA analyzer (ABI3730);

[0044] 3.2 Analysis of results

[0045] 3.2.1 Cluster analysis among varieties

[0046] After summarizing the amplified fragments of 50 SSR primers, the software TASSEL3.0 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular biology and genetic breeding, in particular to a molecular marker SSR primer for genetic relationship and variety identification of rehmannia glutinosa varieties, a kit and application. The 50 pairs of SSR primers provided by the invention are used for respectively amplifying DNA of 17 planting resources in the Huanghuai region, and the derivative relationship, genetic difference, evolution relationship and the like among different varieties are determined through clustering analysis and genetic similarity analysis, so that a scientific basis can be provided for breeding and breeding. Meanwhile, by adopting the 15 pairs of SSR primers provided by the invention, different rehmannia varieties can be accurately distinguished through difference combination of amplification products among different primer pairs, so that the rehmannia varieties in 17 Huanghuai production areas can be distinguished and identified on the DNA level, and the SSR fingerprint spectrum of the rehmannia varieties is formed.

Description

technical field [0001] The invention relates to the technical field of molecular biology and genetic breeding, in particular to the genetic relationship of Rehmannia glutinosa varieties, molecular marker SSR primers for species identification, kits and applications. Background technique [0002] Rehmannia glutinosa Libosch. is a perennial herb of the genus Rehmanniaceae of the scrophulariaceae. Its rhizomes are fleshy and yellow when fresh, hence the name. Rehmannia glutinosa is mainly distributed in Henan, Hebei, Shandong, Tianjin, Shaanxi, Shanxi, Sichuan, Anhui, Jiangsu and Zhejiang in China. As a traditional bulk Chinese medicinal material, Rehmannia glutinosa has the effects of clearing heat and cooling blood, nourishing yin and promoting body fluid. Modern pharmacological studies have shown that Rehmannia glutinosa has positive effects in improving immunity, anti-cancer, and anti-cancer. [0003] The earliest records of cultivars of Rehmannia glutinosa in my country ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 李春鑫张永战陈国参杨铁钢刘永康王艳张英涛杨金星刘彬
Owner HENAN ACAD OF SCI INST OF BIOLOGY LIABILITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com