Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vitamin D3 C-25 site P450 hydroxylase as well as gene, expression vector, strain and application thereof

A D3C-25, expression vector technology, applied in the field of enzyme engineering, can solve the problems of low yield, high production cost, low purity, etc., and achieve the effects of reducing production cost, high specificity, and reducing reaction by-products

Active Publication Date: 2022-04-15
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are problems such as low purity, low yield and high production cost in the above methods.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vitamin D3 C-25 site P450 hydroxylase as well as gene, expression vector, strain and application thereof
  • Vitamin D3 C-25 site P450 hydroxylase as well as gene, expression vector, strain and application thereof
  • Vitamin D3 C-25 site P450 hydroxylase as well as gene, expression vector, strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Metagenome Screening

[0032] Based on metagenomic technology, soil samples were collected in the soil buried with vitamin D3 in advance, and the total DNA of the sample was extracted with a soil genome extraction kit, which was used as a template for metagenomic DNA. Design degenerate primers based on the conserved sequence of P450 enzymes and carry out PCR amplification to screen the target P450 enzyme gene, and then further design primers according to the sequencing results to amplify the complete gene coding sequence by PCR technology. The amplified fragments were sequenced and compared with the NCBI database. Based on the results, primers were further designed to amplify the complete vitamin D3 C-25 hydroxylation P450 enzyme gene coding sequence, which was named vitamin D3C-25 hydroxylation P450 enzyme CYP109E1 -H and its gene sequence cyp109E1-H.

Embodiment 2

[0033] Example 2 Construction of Bacillus subtilis WB600-pMA5-CYP109E1-H

[0034] (1) Cloning of vitamin D3 C-25 P450 hydroxylase CYP109E1-H and its gene sequence cyp109E1-H

[0035] In the early stage, the relevant vitamin D3 C-25 P450 hydroxylase CYP109E1-H and its gene sequence cyp109E1-H were obtained through metagenomic screening, and primers were designed to amplify the target gene. The primer sequence is as follows:

[0036] Primer F:

[0037] AAAAGGAGCGATTTACATATGATGAAAACAGAAAGAGAAAACGGAA;

[0038] Primer R:

[0039] GAGCTCGACTCTAGAGGATCCTTATACGTTTTTACGAATCAATAATTCTTT

[0040] The obtained DNA sequence is used as a template, and the above nucleotide sequence is used as a primer to amplify vitamin D3 C-25 P450 hydroxylase CYP109E1-H and its gene sequence cyp109E1-H by PCR. The PCR reaction was carried out in a 50 μL system, and the reaction conditions were as follows: 3 minutes of pre-denaturation at 95°C followed by cycling; denaturation at 95°C for 30 s, annealing...

Embodiment 3

[0047] Example 3 Optimum temperature of vitamin D3 C-25 P450 hydroxylase CYP109E1-H

[0048] Whole cell transformation was carried out at 30° C. and 37° C. for 72 hours, and other conditions were the same as in Example 2. Calcidiol 25(OH)VD 3 The output is shown in the table below.

[0049]

[0050] It can be seen from the above table that the optimal catalytic temperature of vitamin D3 C-25 P450 hydroxylase CYP109E1-H is 30°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a vitamin D3 C-25 site P450 hydroxylase as well as a gene, an expression vector, a strain and application thereof, and belongs to the technical fields of enzyme engineering and gene engineering. The amino acid sequence of the vitamin D3 C-25 site P450 hydroxylase CYP109E1-H is shown as SEQ ID NO.1, the gene cyp109E1-H is inserted into a pMA5 plasmid, bacillus subtilis WB600 is used as an expression host to construct a strain, heterologous expression of the vitamin D3 C-25 site P450 hydroxylase CYP109E1-H is achieved, efficient conversion of the vitamin D3 is successfully achieved, meanwhile, specificity is high, reaction by-products are reduced, production cost is reduced, and the application prospect is wide. And a foundation is laid for further industrial application.

Description

technical field [0001] The invention relates to the technical field of enzyme engineering, in particular to a vitamin D3 C-25-position P450 hydroxylase and its gene, expression vector, bacterial strain and application. Background technique [0002] In the human body, vitamin D is mainly 3 form, vitamin D 3 It is the most important vitamin D compound. Vitamin D 3 (VD 3 ) is inactive and can only be effective when converted into active metabolites. The main active derivatives of vitamin D3 are 25(OH)VD 3 (calcifediol), 1α,25(OH) 2 VD 3 (calcitriol), etc. Vitamin D 3 Metabolized in the liver to form the metabolite 25(OH)VD 3 , the absorption rate in the body is fast, the property is stable and the half-life is long. Therefore, 25(OH)VD 3 It is used as the best indicator to measure the level of vitamin D available in the body. 25(OH)VD 3 It is generally recognized as safe (GRAS) vitamin D certified by the US Food and Drug Administration (FDA) 3 Metabolites are cli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/75C12N1/21C12P7/18C12R1/125
Inventor 李会许正宏侯懿娜史劲松张晓梅龚劲松
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products