Bispecific antibodies and uses thereof
An antibody, recombinant antibody technology, applied in the direction of antibodies, specific peptides, antiviral agents, etc., can solve problems such as NK cell depletion, achieve significant tumor or viral infection, significant anti-tumor and anti-viral capabilities, treatment or prevention of tumors or Effects of viral infection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0085] Example 1 Design and construction of bispecific antibody molecule anti-CD16a-FCγ4-IL21
[0086] The specific experimental operation of this embodiment is as follows:
[0087] 1.1 Acquisition of anti-CD16a-FCγ4-IL21 fusion gene
[0088] (1) Acquisition of Anti-CD16a-FCγ4 fusion gene
[0089] Using the Pgapza-CD16-FC4γ4 plasmid as a template, use primer 1 and primer 2 to carry out PCR to obtain the anti-CD16a-FCγ4 fusion gene, which has the nucleotide sequence shown in SEQ ID NO:6, and the PCR program is: denaturation: 9820s ; Cycle: 98 10s → 54 15s → 7240s (30 cycles) extension: 72 2min;
[0090] CAAGTTCAATTGGTTCAATCTGGTGCTGAGGTTAAGAAACCAGGTGAGTCTTTGAAGGTTTCTTGTAAGGCTTCTGGTTATACTTTCACTTCTTACTATATGCATTGGGTTAGACAAGCTCCAGGTCAAGGTTTGGAGTGGATGGGTATTATTAATCCATCTGGTGGTTCTACTTCTTATGCTCAAAAGTTCCAAGGTAGAGTTACTATGACTAGAGATACTTCTACTTCTACTGTTTATATGGAGTTGTCTTCTTTGAGATCTGAAGATACTGCTGTTTATTATTGTGCTAGAGGTTCTGCTTATTATTATGATTTCGCTGATTATTGGGGTCAAGGTACTTTGGTTACTGTCTCTTCTGGTGGTGGTGGTTCTGGTG...
Embodiment 2
[0103] Example 2 Expression and purification of bispecific antibody molecule anti-CD16a-FCγ4-IL21
[0104] 2.1 Expression of anti-CD16a-FCγ4-IL21 bispecific antibody molecule
[0105] The positive clone constructed in Example 1 was expanded and cultivated in 50 mL LZ liquid medium, and the plasmid PGAP-zα-anti-CD16a-FCγ4-IL21 was extracted in a large amount using a kit (Axygen Company). The expression plasmid PGAP-zα-anti-CD16a-FCγ4-IL21 prepared in the previous step was linearized with endonuclease SpeI and recovered by ethanol precipitation. Ethanol precipitation steps: 1) Add twice the volume of absolute ethanol and 0.1 times the volume of 3M sodium acetate to the enzyme digestion reaction system, and precipitate at -20°C for more than 2 hours. 2) Centrifuge at 12000 g for 10 minutes, discard the supernatant. 3) The pellet was resuspended in 300 μL of 70% ethanol, centrifuged at 12000 g for 10 minutes, and the supernatant was discarded. 4) Dry at 37°C, resuspend in deion...
Embodiment 3
[0121] Example 3 Verification of the bispecific antibody anti-CD16a-FCγ4-IL21 inducing NK cell activation in vitro
[0122] Human PBMCs were isolated by Ficoll density gradient centrifugation. Dilute the isolated PBMC to 1.0×10 with RPMI1640 containing 10% FBS 6 / mL. Add 10 mL of diluted cells to the T25 culture flask. After culturing for 12 hours, anti-CD16a-FCγ4-IL21 fusion protein was added to the culture flask at a final concentration of 20 nM. After 24 hours of culture, flow cytometry was used to detect the phenotype changes of NK cells, mainly to detect the expression of main activating molecules CD69, NKp44 and killing molecules 4-1BB, TRAIL, and Granzyme B on the surface of NK cells.
[0123] The specific experimental results are as Figure 6 As shown, compared with the control group PBS (Control group), in the experimental group added with anti-CD16a-FCγ4-IL21 fusion protein, the main activating molecules CD69, NKp44 and killing molecules 4-1BB, TRAIL, The expres...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com