Application of NKG2A in detection of human NK cells in mouse humanized tumor model
A NK cell and tumor technology, applied in the biological field, can solve the problems of inability to apply human cell tissue distribution, inability to distinguish human cells and human tumor cells, research and other problems, and achieve low cost, reduce toxic side effects, and reduce uncertainty. sexual effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Screening of Candidate Genes
[0049] 1. Screen candidate genes: Search the expression profiles of NK cells and MOLM13 cells through the NCBI official website, and screen a series of genes that are highly expressed in human NK cells, but not expressed in MOLM13 cells (human tumor cells) or expressed in very few cells.
[0050] The expression levels of candidate specific genes CD2, NKG2A, and NKp46 in NK cells and MOLM13 cells were detected.
[0051] First, use Tiangen RNA extraction kit (RNAprep Pure Cell / Bacteria Kit, #DP403) to extract total mRNA from NK cells and MOLM13 cell samples; according to the amount of 2ug RNA, use Vazyme RNA reverse transcription kit (HiScript II Q RT SuperMix for Qprc, #R223-01) reverse-transcribed mRNA into cDNA, and finally followed the Transgege qPCR kit ( Top Green qPCR SuperMix, #AQ131), the expression of CD2, NKG2A, and NKp46 genes in NK cells and MOLM13 cells was detected by RT-qPCR detection method, and the reaction system is show...
Embodiment 2
[0063] The expression of the obtained genes NKG2A and NKp46 in mouse tissues, MOLM13 cells and NK cells will be screened.
[0064] Mouse tissue preparation: prepare mortar and liquid nitrogen in advance; take out the spleen of the fresh test mouse and put it directly in the mortar poured with liquid nitrogen, add liquid nitrogen while grinding, and keep the liquid nitrogen always present; grind the well Divide the spleen tissue powder into two 1.5ml EB tubes; immediately add 1ml Trizol to one tube, and 700μl lysate from the DP430 kit to the other tube, fully vortex and lyse, 5min (two RNA extraction methods), two The extraction method is shown in Table 4.
[0065] Table 4 Two RNA extraction methods from mouse tissue
[0066] sample method of extraction Elution volume Elution concentration (ng / μl) 260 / 280 260 / 230 1 / 2 mouse spleen powder DP430 30μl 1239.4 2.14 2.02 1 / 2 mouse spleen powder Trizol 50μl 1304 2.05 2.05
[0067] Then RN...
Embodiment 3
[0074] Plasmid standard, cell standard preparation and detection limit determination
[0075] 1. Preparation of plasmid standard
[0076] In this example, the carrier plasmid is pUC57; pUC57, as a commonly used carrier plasmid, does not specifically bind to NKG2A, NKp46 and other gene primers, making the detection more accurate. The plasmid DNA containing NKG2A and NKp46 marker gene structure was prepared by vector plasmid as a standard product. The structure of the standard product is as follows: figure 1 shown. The amplified sequences of the three pairs of primers for plasmid synthesis are shown in Table 6.
[0077] Table 6 Plasmid Synthesis 3 pairs of primers
[0078]
[0079]
[0080] 将三对引物扩增序列首尾相连形成融合基因(SEQ ID NO:19,AGCTCCATTTTAGCAACTGAACAGGAAATAACCTATGCGGAATTAAACCTTCAAAAAGCTTCTCAGGATTTTCAAGGGAATGACAAAACCTATCACTGCAAAGATTTACCATCAGCTCCAGAGAAGCTCATTGTTGGGATCCTGGGAATTATCTGTCTTATCTTAATGGCCTCTGTGGTAACGATAGTTGTGGACCCGAAGTGATCTCGGGAGAGAAGGTGACCTTCTACTGCCGTCTAGACACTGCAACA...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap