Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of gene-enhanced immune cells in lung cancer

An immune cell, enhanced technology, applied in the field of immunology, can solve the problems of insufficient killing ability and difficult expansion of NK cells, and achieve the effect of enhancing killing activity and improving proliferation ability.

Active Publication Date: 2022-06-07
青岛西凯生物技术有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, NK cells have the shortcomings of difficult expansion and insufficient killing ability, so effectively solving these two shortcomings can effectively improve the application of NK cells in the treatment of lung cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene-enhanced immune cells in lung cancer
  • Application of gene-enhanced immune cells in lung cancer
  • Application of gene-enhanced immune cells in lung cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] siRNA of lnc-AL592494.1 promotes NK cell proliferation

[0023] (1) Design the siRNA of lnc-AL592494.1 according to the cDNA sequence SEQ ID NO.1 of lnc-AL592494.1. The designed sequence of si-lnc-AL592494.1 is as follows:

[0024] The sense strand sequence of si-lnc-AL592494.1 is: AUUACAUAUGUAACAAUAC, SEQ ID NO.2;

[0025] The antisense strand sequence of si-lnc-AL592494.1 is: GUAUUGUUACAUAUGUAAU, SEQ ID NO.3;

[0026] (2) si-NC and si-lnc-AL592494.1 were transfected into NK-92 cells,

[0027] (3) After 48h of transfection, extract RNA to detect the expression of lnc-AL592494.1. The primer sequences are as follows:

[0028] Upstream primer: TCACGCATTCATGATTCACTGA, SEQ ID NO.4;

[0029] Downstream primer: TTGCTGGCCTATGGAATGCA, SEQ ID NO.5;

[0030] (4) The transfected NK cells were prepared into a cell suspension and seeded in a cell culture plate, with 500 cells per well, and 5 duplicate wells were set for si-NC and si-lnc-AL592494.1 respectively;

[0031] (5) Aft...

Embodiment 2

[0036] siRNA of lnc-AL592494.1 promotes GraB (granzyme B) and PFP (perforin) expression in NK cells

[0037] 1. Protein extraction

[0038] (1) Collect NK cells after transfection 48 into a centrifuge tube, remove the medium by centrifugation, wash with PBS, and add protein lysate;

[0039] (2) After fully lysing for 30 minutes, centrifuge the centrifuge tube in a centrifuge, and suck the supernatant into a new centrifuge tube;

[0040] (3) Refer to the instructions of the BCA protein concentration detection kit to detect the protein concentration, add the loading buffer to adjust to a uniform concentration, and then put the protein sample into boiling water and cook for 5 minutes to obtain the final protein sample;

[0041] 2. Western blot detection

[0042] (1) Configure electrophoresis gel, install electrophoresis rack, spot protein samples and protein markers, turn on the electrophoresis instrument and adjust it to a constant voltage of 90V for electrophoresis;

[0043]...

Embodiment 3

[0049] siRNA of lnc-AL592494.1 promotes the killing activity of NK cells against lung cancer cell A549

[0050] (1) NK cells transfected with si-NC and si-lnc-AL592494.1 were prepared into 2 × 10 6 / ml of cell suspension as effector cells;

[0051] (2) Duplicate lung cancer A549 cells into 2×10 cells 5 / ml of cell suspension as target cells;

[0052] (3) Mix 1.5ml of A549 cells with 1.5ml of si-NC cells and 1.5ml of si-lnc-AL592494.1 cells;

[0053] (4) Simultaneously set the effector cell and target cell natural release hole, the target cell maximum release hole and the medium natural release hole;

[0054](4) After mixing, the cells were cultured in a cell incubator for 4 hours, then centrifuged in a centrifuge for 10 minutes, and the supernatant was collected;

[0055] (5) After the end, suck 50ul of LDH enzyme reaction solution and 50ul of supernatant into each well and add it to the 96-well plate. After 30min reaction at room temperature in the dark, add 50ul of react...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the application of gene-enhanced immune cells in lung cancer and belongs to the technical field of immunology. The gene-enhanced immune cells provided by the present invention are NK cells transfected with lnc‑AL592494.1 siRNA. The NK cells provided by the invention have stronger proliferative ability and stronger killing activity for lung cancer cells.

Description

technical field [0001] The invention belongs to the technical field of immunology, in particular to the application of a gene-enhanced immune cell in lung cancer. Background technique [0002] Natural killer cells (NK cells) are a major innate immune system lymphocyte in the body discovered by Rolf Kiessling and Ronald Heberman in the 1970s. Important member of the immune system. NK cells play an important role in resisting infection by foreign pathogens and in clearing deteriorating cancer cells. NK does not need antigen sensitization and MHC restriction in recognizing and killing tumor cells, and can secrete a variety of cytokines and chemokines to regulate immune response, so NK plays an important role in tumor cell immunotherapy. [0003] Lung cancer is the most common malignant tumor in my country, and one of the malignant tumors with the highest morbidity and mortality in the world. According to statistics, about 1.8 million people are diagnosed with lung cancer eve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A61K35/17A61K31/713A61P35/00C12N5/10C12N5/0783
CPCC12N15/113C12N5/0646A61K35/17A61K31/713A61P35/00C12N2310/141
Inventor 沈晓延曲青梅相爱玲
Owner 青岛西凯生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com