Photoinduced gene promoter, recombinant vector, construction method of recombinant vector and recombinant bacteria

A technology of recombinant vectors and recombinant bacteria, applied in the field of genetic engineering, can solve the problems of plant toxicity, difficult control, low efficiency, etc., and achieve the effect of easy screening and good specificity

Active Publication Date: 2022-01-04
SHENZHEN UNIV +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The reaction conditions of these chemically induced promoters require the artificial addition of chemically induced substances to activate the expression of the target gene, which is difficult to control and inefficient, and may cause toxicity to plants to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Photoinduced gene promoter, recombinant vector, construction method of recombinant vector and recombinant bacteria
  • Photoinduced gene promoter, recombinant vector, construction method of recombinant vector and recombinant bacteria
  • Photoinduced gene promoter, recombinant vector, construction method of recombinant vector and recombinant bacteria

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0029] In some embodiments, a method for preparing a recombinant vector is also provided, such as figure 1 As shown, it includes the steps:

[0030] S10, using the genomic DNA of wild-type Arabidopsis Col as a template, using an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3 to carry out PCR amplification increase to obtain the light-inducible gene promoter NTP2;

[0031] S20. Perform Kpn1 and Sac1 double enzyme digestion on the pMDC162 plasmid vector fused with the GUS reporter gene and the light-inducible gene promoter NTP2, and gel recovery and purification of the enzyme-digested product by gel electrophoresis to obtain the NTP2 fragment after enzyme digestion and pMDC162 plasmid vector after digestion;

[0032] S30. Using T4 ligase to ligate the digested NTP2 fragment into the digested pMDC162 plasmid vector to construct a recombinant vector pNTP2-GUS.

[0033] This example us...

Embodiment 1

[0038] 1) Log in to the Arabidopsis TAIR database (http:www.arabidopsis.org / ), and design a light-inducible gene promoter based on the promoter region about 1.5Kb upstream of the published Arabidopsis NTP2 (NTP2: AT2G40520) gene sequence NTP2 upstream and downstream amplification primers;

[0039] 2), design the upstream and downstream amplification primers of the light-inducible gene promoter NTP2 as follows:

[0040] The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and its nucleotide sequence is specifically P15'CACCAAACAATTTGGTATTTGGTT3';

[0041] The nucleotide sequence of the downstream amplification primer is shown in SEQ ID NO.3, and its nucleotide sequence is specifically P2: 5'TTGAACAAAAAACAAAGAGAATCAC3'.

[0042] 3), using the genomic DNA of wild-type Arabidopsis Col as a template, using the above-mentioned double primers to carry out PCR amplification, the obtained PCR product is the light-inducible gene promoter NTP2, and it is subjected to ...

Embodiment 2

[0066] 1), using the flower bud soaking method to stably transform Arabidopsis thaliana of the Col-0 ecotype;

[0067] 1. Transformation adopts flower bud soaking method (document YHQ65), takes the plant that grows about one month, and the growth condition is good, and Arabidopsis thaliana can be done decapping treatment one week in advance before transformation, so that plant produces more flower buds, improves transformation efficiency efficiency.

[0068] ②Shake the Agrobacterium plus tertiary antibody liquid medium containing the transgene carrier, then pipette 200μL and add it to 200mL tertiary antibody liquid medium and shake until the OD 600 is about 1.5-2.0.

[0069] ③ Centrifuge the bacterial solution at 8000 rpm for 10 minutes, discard the supernatant and leave the bacterial cells at the bottom.

[0070] ④ Use 4.4g / L MURASHIGE&SKOOG(MS) BASAL MEDIUMw / VITAMINS solution (containing 5% sucrose solution) to resuspend the bacteria solution, add 0.5μL / mL Silwet surfactant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a photoinduced gene promoter, a recombinant vector, a construction method of the recombinant vector and recombinant bacteria. The recombinant vector comprises the photoinduced gene promoter, and the nucleotide sequence of the photoinduced gene promoter is shown as SEQ ID NO.1. According to the invention, the photoinduced gene promoter is used for replacing a constitutive gene promoter, a recombinant vector containing a specific photoinduced promoter is provided, and the recombinant vector is formed by using pMDC162 plasmid fused with a GUS reporter gene as a basic vector and using the photoinduced gene promoter NTP2 as a target sequence. The recombinant vector constructed by the invention has the advantages of good specificity, efficient and stable expression, easiness for screening and the like, a transgenic material for photoinduced expression of a target gene can be rapidly obtained completely on the basis of ensuring illumination, and the recombinant vector is expected to play an important role in regulation and control of expression of the target gene.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a light-inducible gene promoter, a recombinant vector and its construction method, and a recombinant bacterium. Background technique [0002] The growth and development and growth cycle of plants are the result of the ordered expression of different genes in time and space. One of the key links in the regulation of gene expression is the regulation of transcription level, which is realized by the interaction between cis-acting elements and trans-acting factors. The plant gene promoter is an important cis-acting element located in the upstream region of the transcription start site at the 5' end of the structural gene. The transcription factor recognizes a specific DNA sequence of the promoter and further recruits RNA polymerase to start the gene transcription process. Therefore, the promoter It is an important element in the regulation of gene expression. [0003] A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113
CPCC07K14/415C12N15/8205C12N9/2402C12Y302/01031
Inventor 任永兵王菲王晓彦于宇莫蓓莘
Owner SHENZHEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap