Application of gherf017 gene in regulating plant salt tolerance
A technology of salt tolerance and genetics, applied in applications, plant peptides, plant products, etc., can solve problems that have not made significant progress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Cloning and Bioinformatics Analysis of Cotton GhERF017 Gene and Promoter
[0040]CottonFGD retrieves the gene sequence of GhERF017, uses NCBI's Primer-Blast website to design primers, and uses PCR (Polymerase Chain Reaction) method to amplify from upland cotton TM-1. The full-length CDS is 429bp, encoding 142 amino acids. The relative protein The molecular weight is 15.6kDa, and the isoelectric point is 7.75. The gene structure shows that the gene contains an exon, the gene contains AP2 domian, and belongs to group II in the gene family (eg figure 1 ).
[0041] Upstream primer F: 5'-ATGGTGAGGCCGATC-3' (SEQ ID NO.1);
[0042] Downstream primer R: 5'-CTAGAAAGTCCAAACACCAGGAGA-3' (SEQ ID NO. 2).
[0043] The open reading frame sequence (SEQ ID NO. 3) is:
[0044] ATGGTGAGGCCGATCGGGGAAAGAGATGACGGCGGCCGTTACAAGGGTGTACGGATGAGGAAGTGGGGGAAATGGGTAGCGGAAGTACGACAACCCAATAGCCGAGGAAGAATATGGTTGGGTTCTTACAAGACAGCAGAAGAAGCTGCTAGAGCTTACGACGCTGCCGTTTTTTGTCTGCGTGGGAATTCGGCAAAGCTTAACTTTCCC...
Embodiment 2
[0048] Expression pattern analysis of GhERF017 under abiotic stress
[0049] Cotton TM-1 variety was planted in the sand in the artificial climate chamber of this subject, and cultivated at a constant temperature of 25 °C, with 16 hours of light and 6 hours of darkness. Cotton grown to the three-leaf stage was treated with 200mmol / L NaCl solution, ddH 2 O as a control, take 0h, 1h, 3h, 6h, 9h, 12h and 24h of cotton root tissue samples; use 20wt% PEG solution treatment, ddH 2 O as a control, take cotton leaf tissue samples of 0h, 1h, 3h, 6h, 9h, 12h and 24h.
[0050] The cotton TM-1 variety was planted in the nutrient soil in the artificial climate chamber of this subject, and cultivated at a constant temperature of 25°C with 16 hours of light and 6 hours of darkness. Cotton leaves were treated with 100 μmol / L ABA and MeJA at the three-leaf stage, and cotton leaf tissues were collected at 0 h, 0.5 h, 1 h, 3 h, 6 h and 9 h. RNA was extracted from tissue samples, reverse trans...
Embodiment 3
[0098] Cloning of GhERF017CDS Sequence
[0099] 1. During the flowering period of cotton, take the mature cotton leaves of cotton TM-1 variety, quick-freeze them in liquid nitrogen, and store them in a -80° refrigerator for later use. RNA was extracted for reverse transcription.
[0100] 2. PCR reaction system, procedure and product detection of gene cloning
[0101] 1) PCR reaction system
[0102] All operations should be carried out on ice. After thawing each component, please mix thoroughly. After use, please put it back to -20℃ for storage.
[0103]
[0104] 2) PCR reaction program
[0105]
[0106] 3) Detection of PCR products
[0107] Take 2 μL of PCR product, add 2 μL of 6×Loading Buffer, mix well, spot on 1% agarose gel, and detect by electrophoresis.
[0108] 3. Gel recovery of PCR products
[0109] 1) After DNA electrophoresis, quickly cut off the gel containing the target DNA fragments under a UV light. It is recommended to use a paper towel to absorb th...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com