Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of pyrophosphatase gene

A pyrophosphatase and gene technology, applied in the field of microbial gene application, can solve the problems of restricting the large-scale application of lactic acid bacteria, high extraction and purification costs, and low folic acid synthesis amount.

Active Publication Date: 2021-05-18
KUNMING UNIV OF SCI & TECH
View PDF14 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] With the development of the economy, the demand for human health is constantly increasing. The folic acid synthesized by lactic acid bacteria makes it more competitive in the market because of its safety and effectiveness. Factors such as poor stability and high extraction and purification costs restrict the large-scale application of lactic acid bacteria in the industrial production of folic acid. Therefore, the combination of increasingly mature genetic engineering technology on the genetic level of the corresponding strains combined with optimal culture conditions can effectively improve folic acid synthesis. Quantity and cost reduction, and make the industrial production of folic acid from lactic acid bacteria possible

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of pyrophosphatase gene
  • Application of pyrophosphatase gene
  • Application of pyrophosphatase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1: Pyrophosphatase synthetic gene fol Q clone

[0017] Design primers based on YM-4-3 genome sequence, using high-fidelity Taq enzyme pair wxya The gene was amplified by PCR (see Table 1 for the amplification system). After the amplified product was obtained, the poly A tail was connected to its 3' end (product 14.5 μL, Taq buffer 2 μL, dNTP 3 μL, Taq enzyme 0.5 μL, 72°C reaction for 15 minutes), the amplification primers are as follows:

[0018] BDQF: TCCCCCGGGAACAGGCTGGTTGGC;

[0019] BDQR: AACTGCAGTCCGTTGCTTGTGCT;

[0020] Table 1 The PCR amplification system is as follows (50 μL):

[0021] ;

[0022] Amplification conditions: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s; annealing at 55°C for 15 s; extension at 72°C for 1 min; cycle 30 times, and finally extension at 72°C for 10 min; the amplified PCR products were sequenced and compared. According to the sequencing results, a 588bp long sequence was obtained, and the nucleotid...

Embodiment 2

[0023] Example 2: Construction of YM-4-3 with plasmid pMG36e as backbone fol Q overexpression strain

[0024] 1. The target gene amplified in Example 1 fol The Q fragment and the pMG36e plasmid were Pst I. Sma Ⅰ two restriction endonucleases for digestion, the digestion system is as follows:

[0025] ;

[0026] After digestion at 37°C for 4 hours, use 2% agarose gel electrophoresis to identify, refer to the manual of the gel recovery kit to recover the enzyme digestion products, and store at -20°C.

[0027] 2. Enzyme digestion product connection

[0028] After purification, the digested product was ligated with T4 ligase, and ligated overnight at 16°C. The ligation system was as follows (10 μL):

[0029] ;

[0030] 3. Transformation of the ligation product into Escherichia coli DH5α strain and verification

[0031] 1) Take out the prepared competent E. coli DH5α from the -80°C refrigerator, and after thawing on ice, add all the ligation products that have been ...

Embodiment 3

[0045] Example 3: Determination of folic acid content and OD600 value

[0046] Take out the activated YML4-3 strain and BDQ strain, and inoculate them into 50 mL liquid MRS medium containing no antibiotics and 50 μg / mL erythromycin, respectively, and take samples every 12 h to measure the OD of the samples 600 value, and use LC-MS to measure folic acid content, the specific method is:

[0047] The bacterial liquid obtained every 12 hours was crushed using an ultrasonic breaker, and the conditions were: ultrasonic for 5 s, stop for 5 s, amplitude 30%, 10 min. After crushing, centrifuge at 4°C and 12,000 rpm / min for 3 min, and take the supernatant into a liquid phase vial for quantitative analysis by LC-Qtrap MS.

[0048] Chromatographic conditions: the sample enters the mass spectrometer through an autosampler connected to the double pass for detection; the mobile phase is A (water, containing 5 mmol / L ammonium formate) and B (methanol, containing 5 mmol / L ammonium formate), i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a pyrophosphatase gene and application of pyrophosphatase gene folQ in improvement of lactobacillus plantarum folic acid synthesis. The nucleotide sequence of the pyrophosphatase gene folQ is as shown in SEQ ID NO: 1. The application comprises the following steps of carrying out enzyme digestion connection on the gene folQ and a constitutive vector pMG36e to obtain a recombinant expression vector, transferring the recombinant expression vector into lactobacillus plantarum YM-4-3, and realizing overexpression of the gene folQ in a YM-4-3 strain body to obtain an overexpression strain. An LC-MS method is adopted to measure the folic acid producing capacity of the strain, it is found that compared with a wild type strain, the content of folic acid monoglutamic acid produced by the BDQ strain is increased, the folQ gene plays a key role in folic acid synthesis, and therefore the pyrophosphatase gene has huge potential in the fields of folic acid biosynthesis research and application.

Description

technical field [0001] The invention belongs to the field of microbial gene application, in particular to pyrophosphatase gene wxya In improving Lactobacillus plantarum ( Lactobacillus plantarum ) Application of YM-4-3 folic acid biosynthesis. Background technique [0002] Lactic acid bacteria (Lactic Acid Bacteria) is a general term for a class of microorganisms that are generally recognized as safe to ferment glucose or produce lactic acid with lactose. Not only are they found in inorganic environments, but they are also common in human, animal guts, etc. Traditionally associated with fermented foods and closely linked to human culture and well-being, lactic acid bacteria have historically been associated with sensory It is widely known for its positive contribution in terms of quality, quality and safety. [0003] Folic acid, vitamin B9, is a water-soluble B vitamin. It is composed of pterin, p-aminobenzoic acid (p-aminobenzoic acid, p ABA) combined with one or more...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/74C12N1/21C12R1/25
CPCC12N9/14C12Y306/01C12N15/746Y02P20/55
Inventor 柳陈坚陈斯谦李晓然
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com