Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for measuring T4 polynucleotide kinase activity based on magnetic nanomaterials and biological signal amplification technology

A polynucleotide and magnetic nanotechnology, applied in the field of biochemical analysis, can solve the problems of application limitation, cumbersome operation process and high cost, and achieve the effect of improving selectivity and specificity

Active Publication Date: 2022-02-18
YUNNAN MINZU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this type of method has high sensitivity, the operation process is cumbersome and the cost is high, and its application is limited to a certain extent.
[0005] At present, there is a lack of a method for the determination of T4 polynucleotide kinase activity based on magnetic nanomaterials and biological signal amplification technology that achieves highly sensitive, rapid and quantitative determination of T4 PNK activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for measuring T4 polynucleotide kinase activity based on magnetic nanomaterials and biological signal amplification technology
  • Method for measuring T4 polynucleotide kinase activity based on magnetic nanomaterials and biological signal amplification technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] The present invention is based on Fe 3 o 4 @TiO 2 The principle of the method for detecting T4PNK activity by dual signal amplification technology of magnetic core-shell nanoparticles and biological signals is as follows: figure 1 shown. First prepare the Fe 3 o 4 @TiO 2 In the presence of magnetic core-shell nanoparticles, ATP and T4 PNK, the 5′ end of the primer strand S1 in the rolling circle amplification reaction was phosphorylated, and the phosphorylated primer strand S1 passed through the reaction with TiO 2 Specific reaction, modified to Fe 3 o 4 @TiO 2 Magnetic nanoparticle surfaces. Join Ring Template S 2 , in the presence of T4 DNA ligase, S2 and Fe 3 o 4 @TiO 2 The S1 hybridization of the primer strand on the surface of the magnetic nanoparticle forms a circular mixture. In the presence of phi29 DNA polymerase and dNTPs, Fe 3 o 4 @TiO 2 RCA reaction occurs on the surface of magnetic nanoparticles. Ferrocene-labeled nucleic acid chain S3 (Fc...

Embodiment 2

[0041] Oligonucleotide sequence design

[0042] The oligonucleotide sequence designed in the present invention was synthesized by China Shanghai Sangon Bioengineering Co., Ltd., purified and tested by HPLC, and freeze-dried. The oligonucleotide sequence designed by the present invention is as follows:

[0043] S1: 5'-TTTTTTCACAGAGGATAGGACATGA-3';

[0044] S2: 5′-PO 4 - CTCAGCTGTGAACAACTAGAAGATAACTGTGAAGATCGCTTATCATGTCCTATC-3';

[0045] S3: 5′-NH 2 -TTTTTTTTTAAGATAACTGTGATTTTTTTT-NH 2 -3';

[0046] The oligonucleotides were dissolved in ultrapure sterile water and stored at -18°C for later use.

Embodiment 3

[0048] Fe 3 o 4 @TiO 2 Preparation of Magnetic Core-Shell Nanoparticles

[0049] Weigh 0.615g FeCl 3 ·6H 2 Dissolve O in 20 mL of ethylene glycol, add 1.8 g of NaAc and 0.5 g of polyethylene glycol, stir the solution, transfer it to a 100 mL Teflon-lined stainless steel autoclave, react at 200 °C for 8 hours, and cool to room temperature , washed several times with ethanol, separated by magnetic force, and air-dried at room temperature to obtain Fe 3 o 4 magnetic nanoparticles. Take 9.6mL glacial acetic acid and 6.8mL butyl titanate and dissolve in 60mL ethanol, add 0.4g Fe 3 o 4 Magnetic nanoparticles were ultrasonically dispersed for 15 min, 2.4 g of polyethylene glycol and 3.6 g of urea were added, stirred electrically for 1 h, and then the mixture was transferred to a reaction vessel for crystallization at 180° C. for 8 h. After cooling to room temperature, the precipitate was filtered and washed several times with ethanol, and dried at 80 °C for 12 h to give Fe ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for measuring the activity of T4 polynucleotide kinase based on magnetic nanomaterials and biological signal amplification technology, and adopts a hydrothermal method to prepare Fe 3 o 4 @TiO 2 In the presence of magnetic core-shell nanoparticles, ATP and T4 PNK, the 5′ end of primer strand S1 in rolling circle amplification reaction was phosphorylated and modified to Fe 3 o 4 @TiO 2 Magnetic nanoparticle surface; adding circular template S2, nucleic acid strand S2 and Fe 3 o 4 @TiO 2 Hybridization of primer strand S1 on the surface of magnetic nanoparticles to form a circular mixture; Fe 3 o 4 @TiO 2 RCA reaction occurs on the surface of magnetic nanoparticles; ferrocene-labeled nucleic acid chain S3 is added, and Fc-S3 hybridizes with the RCA reaction product, and is modified to the surface of magnetic nanoparticles to enhance the electrochemical response signal; through the magnetic enrichment and electrochemical reaction of GME Responsive signal for highly sensitive and quantitative determination of T4 PNK activity.

Description

technical field [0001] The invention relates to the technical field of biochemical analysis, in particular to a method for measuring T4 polynucleotide kinase activity based on magnetic nanomaterials and biological signal amplification technology. Background technique [0002] T4 polynucleotide kinase (T4 PNK) is a protein encoded by the pseT gene of bacteriophage. It has 5' kinase activity and can catalyze the phosphorylation of the 5' hydroxyl terminal of nucleic acid, and DNA recombination, Normal cellular activities such as replication and damage repair are closely related. In addition, T4 PNK is also an important molecular biology tool, and the discovery and application of T4 PNK has promoted the development of molecular biology to a certain extent. At present, T4 PNK has become an indispensable tool enzyme in genetic engineering and bioanalysis research, and is further used in the research of nucleic acid damage repair and enzyme inhibitors. Therefore, the determinati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N27/327C12Q1/6844C12Q1/682
CPCG01N27/3278G01N27/3277C12Q1/682C12Q1/6844
Inventor 张艳丽刘在琼庞鹏飞王红斌
Owner YUNNAN MINZU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com