Biological agents for inhibiting response of cells to inflammatory factor stimuli
A technology for inhibiting cells and cytokines, applied in the field of biomedicine, can solve the problem of few types of TNF-α inhibitors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1Y
[0051] Example 1 YAP knockdown (KD) enhances the expression of TNF-α-induced genes
[0052] RNAiMAX TM Transfection Reagent Transfect control or YAP1 interfering RNA (siRNA) into FLS cells (or HCT-8 cells / THP-1 cells / PBMCs cells; RNAiMAXTM transfection reagent is also used when transfecting HCT-8 cell lines, transfect THP When transfecting PBMC, use control lentivirus or YAP1shRNA lentivirus to infect cells). After 2 days, the control group (treatment method is control siRNA) is not stimulated. The cells in the experimental group were stimulated with TNF-α or LPS, RNA was extracted and interleukin-8 (IL-8) mRNA level was measured by qPCR, and the cell culture supernatant was taken to measure the IL-8 content by ELISA method. The specific operations were as follows:
[0053] 1. Human PBMC isolation and culture
[0054] The use of peripheral blood from healthy adults was approved by the Ethics Committee of Guangzhou Medical University, and the extraction of peripheral blood ob...
Embodiment 2Y
[0077] Example 2 YAP1 knockout enhances the expression of TNF-α-induced genes
[0078] 1. CRISPR / Cas9 gene editing technology
[0079] The human YAP1 gene is knocked out by CRISPR / Cas9 method, and the guideRNA sequence is as follows:
[0080] sgRNA #1: CCCTGCGGGGGCTGCGAAGG
[0081] sgRNA #2: ACCCGGGCAACCGGCACCCG.
[0082] The two sgRNAs were integrated into the vector pGE-4 (pU6gRNA1UgRNA2Cas9puro), and the constructed YAP1 KO plasmid was transfected into cells using standard experimental procedures, and then screened with 2 μg / ml puromycin after transfection.
[0083] 2. Western blotting (WB): according to the standard experimental procedure, all the antibodies used were purchased from Cell Signaling Technology.
[0084] 3. Results
[0085] The present invention uses CRISPR / Cas9 to knock out the proline-rich region (PRD) of YAP1 in HCT-8 cells, the results are as follows Figure 5 as shown, Figure 5 A shows, compared with the control group C (control plasmid empty), af...
Embodiment 3Y
[0087] Example 3 Effect of YAP1 on TNF-α signaling pathway
[0088] Acting on cells, TNF-α rapidly activates multiple pathways, leading to transcription of many genes including cytokines and chemokines. Among these signaling pathways, the NF-κB and MAP kinase pathways are critical.
[0089] In this example, the effect of YAP1 on the TNF-α signaling pathway was studied by examining the effect of YAP1 knockout and YAP1 knockdown on NF-κB and MAP kinase pathways (using Western blot method).
[0090] The result is as Figure 6 As shown, both YAP1 knockdown (KD) and knockout (KO) significantly enhanced the phosphorylation level of p65 (phosphorylated p65 is p-p65, which is one of the components of the NF-κB pathway), and the phosphorylation levels of p38 and ERK (Phosphorylated p38, namely p-p38 and phosphorylated ERK, namely p-ERK, are elements of the MAP kinase family); indicating that knockdown or knockout of YAP1 can enhance the TNF-α signaling pathway.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com