Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for increasing plant cellulose content by utilizing apple fructokinase gene

A technology of plant cellulose and fructokinase, applied in the field of genetic engineering, can solve the problem of ambiguous cellulose biomass in stems

Pending Publication Date: 2021-01-05
NORTHWEST A & F UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether heterologous expression of the apple fructokinase gene MdFRK2 in poplar has the ability to improve cellulosic biomass in stems remains unclear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing plant cellulose content by utilizing apple fructokinase gene
  • Method for increasing plant cellulose content by utilizing apple fructokinase gene
  • Method for increasing plant cellulose content by utilizing apple fructokinase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0040] The invention provides an apple fructokinase gene MdFRK2, the nucleotide sequence of which is shown in SEQ ID NO.1:

[0041] SEQ ID NO.1:

[0042] ATGGCTAACAATGGCGTACCGCAGACCGGAAAGGGTATGATCGTGAGTTTCGGCGAGATGCTGATCGACTTCGTCCCCACCGAATCGGGCGTTTCTCTTGCCGAAGCTCCTGGCTTCCTCAAAGCCCCAGGCGGGGCCCCCGCCAACGTGGCGATCGCCGTGGCTCGCCTCGGCGGAAAGGCCGCGTTCGTCGGAAAACTCGGCGACGACGAGTTCGGCCACATGCTCGCCGGCATCCTGAAGAAATACGGCGTCGCTGGAGAAGGCATCTCGTTCGATCAGGGCGCCCGCACCGCCTTGGCCTTCGTGACCCTACGCGCCGACGGTGAACGTGAGTTCATGTTCTACCGGAACCCTAGCGCCGATATGCTGCTGAAGCCCGACGAGCTCAACATCGAGCTCATCAAATCCGCCAAAGTGTTCCACTATGGATCCATTAGCTTGATCGTGGAGCCGTGCAGATCGGCACATCTGAAGGCAATGGAGGTGGCTAAAGAAGCAGGTGCATTGCTCTCCTACGACCCGAACCTCCGGGAGCCGCTGTGGCCGTCGCGGGAAGAGGCAAAGAAGCAGATAATGAGCATATGGGATAAGGCCGATGTGATCAAGGTGAGTGATGTGGAGCTGGAGTTCCTTACAGGGAGCCCCAAGATTGATGATGCCAATGCCATGACACTGTGGAGAGATAGCTTGAAGCTCCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for increasing the plant cellulose content by utilizing an apple fructokinase gene. An apple fructokinase gene MdFRK2, a recombinant overexpression vector containing the apple fructokinase gene MdFRK2 and recombinant bacteria containing the apple fructokinase gene MdFRK2 are involved in the method. The apple fructokinase gene MdFRK2 in the method can be used for increasing the cellulose content; and the method plays an important role in cell wall transformation and green energy development.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to an apple fructokinase gene MdFRK2. [0002] The invention also relates to a recombinant overexpression vector containing the apple fructokinase gene MdFRK2. [0003] The invention also relates to a method for increasing plant cellulose content by using apple fructokinase gene MdFRK2. Background technique [0004] The cell wall is one of the important features of plant cells. About 70% of photosynthetic products in nature are converted into polymers and accumulate in cell walls. Cell wall biomass is the most abundant renewable resource on earth (Dominique Loqué et al., 2015). However, the non-renewability of fossil energy has become a major challenge to the sustainable development of mankind. Therefore, exploring how to convert cell wall biomass into usable energy is of great significance to the sustainable development of human society. [0005] The cell wall structur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/82A01H5/00A01H6/00
CPCC12N9/1205C12N15/8246C12Y207/01004
Inventor 李明军苏静杨静静祝令成马锋旺
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com