Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and application of pancreatic cancer animal model based on gene knockout Syrian hamster

A Syrian hamster, gene knockout technology, applied in the directions of botanical equipment and methods, biochemical equipment and methods, and other methods of inserting foreign genetic materials, which can solve the problems of lymphopenia, damage to lymphatic development, reduction, etc.

Inactive Publication Date: 2020-12-18
ZHENGZHOU UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The immunodeficiency Syrian hamster (ZZU001) with knockout of the il2rg gene of the present invention is characterized by severe immunodeficiency of T cells, B cells, and NK cells, including: impaired lymphatic development; hypoplasia of the thymus; decreased spleen volume Small, thinner and looser tissues, significantly decreased lymphocytes in the white pulp; significantly decreased lymphocytes in the thymus and spleen, and almost no CD3+ or CD4+ positive T cells; significantly decreased splenocytes and MHC class II positive cells in the spleen; Significantly reduced number of thymocytes, no MHC class II expressing cells; inability to produce neutralizing antibodies against adenovirus type 5 after infection with adenovirus type 5

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of pancreatic cancer animal model based on gene knockout Syrian hamster
  • Preparation method and application of pancreatic cancer animal model based on gene knockout Syrian hamster
  • Preparation method and application of pancreatic cancer animal model based on gene knockout Syrian hamster

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Example 1 Establishment and Identification of Immunodeficient Syrian Hamsters with il2rg Gene Knockout

[0075] 1. Design and prepare Cas9 mRNA and sgRNA

[0076]As a specific embodiment, in step (1), the Cas9 mRNA was purified by the MinElute PCR Purification Kit according to the instructions to recover the linearized T7 promoter vector plasmid, and then the MEGAshort Kit was used to transcribe in vitro according to the instructions; the design target of the sgRNA was il2rg A site-specific sequence within the first exon of the gene (NW_004801714.1). The sgRNA sequence was designed using the online software Benchling (https: / / benchling.com / ), and its predicted on-target efficiency and off-target efficiency were predicted. The sequence used in this experiment example is: GAGCAGCTGAAGGAGTAAGA;

[0077] 2. Microinjection and Embryo Transfer

[0078] Using mineral oil-coated HECM-9 medium as the injection medium, Cas9 mRNA (100 ng / μL) and sgRNA (50ng / μL) were injected in...

Embodiment 2

[0089] Example 2 Establishment of pancreatic cancer model based on knockout of il2rg gene in Syrian hamster

[0090] 1. At the age of 5 weeks, male, il2rg knockout Syrian hamsters were subcutaneously injected with 5×106 MIA-PaCa2 or other cells on the upper right side. Tumor size was measured twice a week using calipers until the tumor reached 3,500 mm3 or tumor ulceration occurred. Tumor volume (V) was calculated using the formula V=(length×width2×π) / 6).

[0091] 2. As a specific embodiment, in step (2), anesthetize il2rg gene knockout Syrian hamsters with 1.2% Avertin solution (45 mg / kg) and expose the pancreas, and suspend 1×106 using basement membrane matrigel For MIA-PaCa2 cells, the cell suspension was injected vertically into the tail of the pancreas using a 29-gauge needle. The pancreas was put back in place and the abdominal cavity was closed. After 10 weeks, the above hamsters were killed with CO2. If hamsters develop ascites, jaundice, cachexia, or both that are a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of animal model construction, particularly relates to a preparation method and application of a pancreatic cancer animal model based on a gene knockout Syrian hamster, provides an il2rg gene knockout immunodeficiency Syrian hamster, and a pancreatic cancer animal model based on the il2rg gene knockout immunodeficiency Syrian hamster, and further provides a preparation method of the hamster and pancreatic cancer model, and a use of the hamster and pancreatic cancer model as a model mouse for the pathological and physiological research of the human body. The anatomy, physiology and pathology of the hamster are very similar to those of human beings, the clinical symptoms, tumor biology, metabolic disorders, molecular genetic changes and other aspects of the hamster are almost completely the same as those of human diseases, and the pancreatic cancer animal model based on ZZU001 can more comprehensively observe main characteristics of human pancreatic cancer, so that a reliable and economic animal model is provided for the disease progression and clinical intervention research of pancreatic cancer and other immunodeficiency diseases, and thefar-reaching scientific research significance and important popularization prospects are achieved.

Description

technical field [0001] The invention belongs to the technical field of animal model construction, and in particular relates to a method for preparing an animal model of pancreatic cancer based on a gene knockout Syrian hamster and its application. Background technique [0002] Pancreatic cancer (PaCa) is one of the deadliest diseases in humans, with a 5-year survival rate of less than 7%. The multiple metastatic sites of human pancreatic cancer remain an important obstacle in the treatment of this disease. Therefore, to better understand the molecular mechanisms of human pancreatic cancer tumorigenesis, develop practical methods for early diagnosis, and evaluate new therapeutic agents, reliable animal models that mimic the clinical features of the disease are needed. [0003] Several models have been developed for the study of human pancreatic cancer, such as human pancreatic cancer cell lines, cell line-based and patient-derived tumor xenografts, transgenic mouse models, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/89C12N15/113C12N15/12A01K67/027
CPCC12N15/89C12N15/1138C07K14/7155A01K67/0276C12N2310/20A01K2217/075A01K2227/105A01K2267/0387
Inventor 王尧河苗晋鑫
Owner ZHENGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com