Fluorescent quantitation PCR detection primer and kit for Sf-rhabdovirus
A detection kit, fluorescence quantitative technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of high cost, cumbersome sample preparation, low detection sensitivity, etc. Strong performance, good quantitative effect and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Design and screening of primers
[0042] The Sf rhabdovirus belongs to the Rhabdoviridae family (Rhabdoviridae), and is a negative-strand RNA virus. Its particles are bullet-shaped or rod-shaped, and the full-length gene is 13534-bp. Design specific primer sequences for the conserved L-protein coding region of Rhabdovirus, and the GenBank accession No. on NCBI is KF947078.
[0043] 1) Design of primers
[0044] Sf rhabdovirus belongs to the Rhabdoviridae family (Rhabdoviridae), which is a negative-strand RNA virus. Its particles are bullet-shaped or rod-shaped. The full-length gene is 13534-bp. The GenBank accession No. on NCBI is KF947078.
[0045] Through the analysis of the L protein coding region of the rhabdovirus in insect cells, the rhabdovirus primer sequence was designed:
[0046] RhF1: CCCCGGAAGAATATGCCCTC (SEQ ID NO. 1);
[0047] RhR1: GCCACTGCAGAGTACAGGTT (SEQ ID NO. 2);
[0048] RhvF1: GCAAGGCTGTTTGGATTACTGAC (SEQ ID NO. 3);
[0049] RhvR1: CAG...
Embodiment 2
[0076] The fluorescent quantitative PCR detection method of embodiment 2 Sf rhabdovirus
[0077] A fluorescent quantitative PCR detection method for Sf rhabdovirus, comprising the following steps:
[0078] S1. Extract RNA from the sample;
[0079] S2. Reverse transcribe the RNA to obtain cDNA;
[0080] S3. Using cDNA as a template and using primers to perform fluorescent quantitative PCR detection;
[0081] S4. Analyzing the Ct value of the test result to determine whether the sample contains Rhabdovirus.
[0082] The RT-PCR amplification reaction system is: 10 μL of TB Green Fast qPCR Mix (2X); 0.4 μL of 50×ROXReference Dye II; 0.4 μL of RhF1 primer (10 μmol / L); 0.4 μL of RhR1 primer (10 μmol / L) ; 2 μL of cDNA template; add ddH2O to make up volume to 20 μL.
[0083] RT-PCR amplification reaction program: 95°C pre-denaturation for 2 minutes, 95°C for 5 seconds, 60°C for 30 seconds, 40 cycles, end. Dissolving program: 95°C for 15 seconds, 60°C for 30 seconds, from 60°C to ...
Embodiment 3
[0090] Fluorescent quantitative PCR sensitivity test of embodiment 3 Sf rhabdovirus
[0091] The plasmid containing the rhabdovirus sequence-positive clone prepared in Example 1 was diluted to 8 concentrations, and the corresponding copy number was 8E*10-10 copy number. According to the fluorescent quantitative PCR detection method in Example 2, the positive clone plasmids with gradient concentrations were detected, and the RhF1 / R1 primer pair with the best sensitivity and specificity was selected, and the amplification curve was as attached. Figure 5 As shown, the dissolution curve is shown in the attached Figure 6 As shown, the standard curve is attached Figure 7 shown.
[0092] Figure 5 Among them, A: 10 copy number; B: 100 copy number; C: 3E*10 copy number; D: 4E*10 copy number; E: 5E*10 copy number; F: 6E*10 copy number; G: 7E* 10 copy number; H:8E*10 copy number.
[0093] From attached Figure 5 It can be seen that the plasmids of each copy number of A-H have g...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com