A specific detection target of Phytophthora winteris phibe_s00001g00026.1 and its application
A winter-growing Phytophthora specific technology, applied in the field of gene detection, can solve the problems of long cycle, poor specificity of detection methods, few specific detection targets, etc., and achieve the effect of high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] 1791 Phytophthora winteris-specific genes were obtained through whole-genome sequence alignment, and a high-reliability specific molecular detection target Phibe_s00001g00026.1 was excavated from it. Its DNA sequence is shown in SEQ ID NO: 1, and its position in the genome It is scaffold_1:26758-26364 (395bp), its CDS sequence is shown in SEQ ID NO: 2, and its protein sequence is shown in SEQ ID NO: 3, and a sensitive and accurate PCR detection technology system is established based on this new target.
[0028] The PCR detection primer composition used in this detection technology system: by the upstream primer Phi-F and the downstream primer Phi-R, the specific sequences of each primer are as follows:
[0029] Phi-F: ATGACGCCGACACGTTGTAA (SEQ ID NO: 4)
[0030] Phi-R: TCATTGGTCAGCCAATCCGA (SEQ ID NO: 5)
[0031] Extract the DNA of the microorganism to be tested, take 1 μL of the DNA solution, add 23 μL of the detection solution in the kit and 1 μL of sterilized deioni...
Embodiment 2
[0034] In order to verify the specific primer sequence of P. DNA from Phytophthora winteris. The specific method is as follows: Take a small amount of mycelium powder, add 900 μL 2% CTAB extract and 90 μL 10% SDS, vortex and mix well, put in a water bath at 55°C for 1 hour, and invert several times every 10 minutes. Centrifuge at 12000rpm for 10min, take the supernatant and add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1), mix by inverting, centrifuge at 12000rpm for 10min; transfer the supernatant to a new tube, add an equal volume of chloroform, and mix gently by inverting Evenly, centrifuge at 12000rpm for 5min. Transfer the supernatant to a new tube, add 2 times the volume of absolute ethanol and 1 / 10 volume of 3M NaAc (pH5.2), and precipitate at -20°C (>1h). Centrifuge at 12000 rpm for 10 min, pour off the supernatant, wash the precipitate twice with 70% ethanol, and dry at room temperature. Add an appropriate amount of sterilized ultrapure water or T...
Embodiment 3
[0041] For the selection of the specific detection target of Phytophthora winteris and the design of the PCR primer set, the present invention preliminarily selected 6 targets (Phibe_s00001g00026.1, Phibe_s00001g00031.1, Phibe_s00041g00025.1, Phibe_s00041g00026.1, Phibe_s00041g00028.1) and Based on 6 targets, multiple pairs of qualified primers were designed, and finally a new target for specific detection, Phibe_s00001g00026.1, was screened out, and a set of primers with the most specific and high sensitivity was designed based on this target, that is, the one described in Example 1. The primer composition used (upstream primer Phi-F and downstream primer Phi-R). Using the primers designed for the remaining 5 detection targets, the specificity of the PCR test results shows that the specificity is not high. Taking the target Phibe_s00001g00031.1 as an example, the actual primer sequence is: Phi-31F: 5'-TCCGGGTGCTGGGAACTCCG-3' (SEQ ID NO: 6); Phi-31R: TCAGCCAGGTGGGAACATTA-3' (S...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com