Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A new specific detection target phibe_s00003g00002.1 of Phytophthora winteris and its application

A specific technology of Phytophthora winteris, which is applied in the field of gene detection, can solve the problems of long period, poor specificity and low sensitivity of the detection method, and achieve the effects of convenient operation, fast detection speed and expanded use range

Active Publication Date: 2020-10-30
NANJING FORESTRY UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the problems of long period required, poor specificity and low sensitivity of the biological detection method of Phytophthora winteris in the prior art, the purpose of the present invention is to provide a new detection target of Phytophthora winteris Phibe_s00003g00002.1 and The RPA-LFD detection primer composition that its target establishes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A new specific detection target phibe_s00003g00002.1 of Phytophthora winteris and its application
  • A new specific detection target phibe_s00003g00002.1 of Phytophthora winteris and its application
  • A new specific detection target phibe_s00003g00002.1 of Phytophthora winteris and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] More than 1,700 specific genes of Phytophthora hibernalis were obtained through whole-genome sequence alignment, and a high-reliability specific molecular detection target Phibe_s00003g00002.1 was excavated from it, whose DNA sequence is shown in SEQ ID NO: 1 , the protein sequence of which is shown in SEQ ID NO:2.

[0042] Based on this new target, a sensitive and accurate RPA-LFD detection technology system was established. The RPA-LFD detection primer composition used in the RPA-LFD detection technology system: consists of forward primer Phi2RPA-F (SEQ ID NO: 3), reverse primer Phi2RPA-R (SEQ ID NO: 4) and probe Phi2RPA -P (SEQ ID NO: 5); the specific sequences of each primer and probe are as follows:

[0043] Phi2RPA-F: ATGCCATGGGCTCTAGACCACCCGCCTCTAACTG (SEQ ID NO: 3);

[0044] Phi2RPA-R: TTATGCGCTGATCGAACTCCATTCTTTTTTTATC (SEQ ID NO: 4);

[0045] Phi2RPA-P: 5'-FAM-AGACGAAGCGCTTGACCTGCCCGAGTACAT-THF-TATACTGCACAGAAC-C3spacer-3'; (SEQ ID NO: 5).

[0046]The metho...

Embodiment 2

[0050] In order to verify the specificity of the RPA lateral flow chromatography test strip detection method, using Phytophthora hibernalis (Phytophthorahibernalis) strains and other Phytophthora and pathogenic bacteria as test materials (Table 1), the RPA lateral flow chromatography test strip detection method The results show that there are two brown bands on the test strip of Phytophthora hibernalis, one is located in the quality control area (Control Line), and the other is located in the test area (Test Line), the result is positive, and the other Phytophthora And the test strip of pathogenic bacteria only has a brown band in the quality control area, and there is no band in the test area (Test Line), then the result is negative, indicating that the sample does not contain Phytophthora hibernalis.

[0051] Select different species (Phytophthora cedarus; Phytophthora cloves; Phytophthora cloves; Phytophthora meloni; Phytophthora infestans; Phytophthora, etc.) Mold; Fusariu...

Embodiment 3

[0059] Use the genomic DNA of the standard strain of Phytophthora winteris at the same concentration as the amplification template, and use the upstream and downstream primers Phi2RPA-F / Phi2RPA-R to carry out the PCR amplification reaction, image 3 It is based on the specific detection results of ordinary PCR based on the high-reliability specific molecular detection target Phibe_s00003g00002.1. Only Phytophthora winteris can amplify a specific band of 300bp, while other Phytophthora and fungi have no amplification . The upstream and downstream primers designed based on the newly discovered detection target Phibe_s00003g00002.1 are also suitable for the amplification of ordinary PCR, which once again proves that the newly discovered detection target Phibe_s00003g00002.1 has specificity among species. 1: Phytophthora hibernalis; 2: P. lateralis; 3: P. syringae; 4: P. cambivora; 5: melons Phytophthora (P.melonis); 6: Phytophthora infestans (P.infestans); 7: Phytophthora (P.cac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a new detection target Phibe_s00003g00002.1 of Phytophthora winteris and its special detection primer and detection method. The DNA sequence of the detection target Phibe_s00003g00002.1 is shown in SEQ ID NO: 1, and the protein sequence is shown in SEQ ID NO : 2 shown. At the same time, the specific primer and probe combination of the RPA detection technology for the specific detection target Phibe_s00003g00002.1 is disclosed. The sequence of the forward primer is shown in SEQ ID NO: 3, and the sequence of the reverse primer is shown in SEQ ID NO: 4 , the probe sequence is shown in SEQ ID NO:5. The present invention has discovered a new detection target, and the rapid detection method based on the target has high accuracy, strong specificity, convenient operation, good practicability, and constant temperature amplification. At the same time, the primer and probe combination designed by the present invention are used for RPA‑LFD detection technology, with its strong specificity and high sensitivity, provides a new technical platform for the detection of Phytophthora hibernalis.

Description

technical field [0001] The invention belongs to the technical field of gene detection, and in particular relates to a specific new detection target Phibe_s00003g00002.1 of Phytophthora winteris and its application. Background technique [0002] Phytophthora (Phytophthora), once any plant is infected by it, it will be doomed and the damage will be serious. So, the Latin Phytophthora is described as: Destroyer of plants. Phyto, in the original Greek, means plant, and phthora means destruction. There are more than 100 species of Phytophthora officially reported, and many Phytophthora have records of seriously endangering agricultural production safety. It can be said that all of them are destroyers of crops, ranging from lack of seedlings and ridges, to severe yields. loss, or even extinction. Therefore, it is of great significance to prevent foreign harmful quarantine Phytophthora from being introduced into our country. my country's entry quarantine list includes Phytophth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C07K14/37C12Q1/6895C12Q1/6844C12Q1/04C12N15/11C12R1/645
CPCC07K14/37C12Q1/6844C12Q1/6895C12Q2521/507C12Q2565/625
Inventor 戴婷婷胡涛汪澳华焦彬彬严娟廖婷婷陈贞鹏
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com