Bifidobacterium lactis capable of preventing osteoporosis and application of bifidobacterium lactis capable of preventing osteoporosis
A technology of bifidobacterium lactis and living bacteria, applied in the field of microbiology, to achieve the effect of preventing and treating osteoporosis, with wide application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1: Bifidobacterium lactis BL-99 and performance measurement thereof
[0043] The Bifidobacterium lactis BL-99 of the present invention is from Shanghai Jiaoda Only Co., Ltd., and is isolated from the intestinal tract of infants. The strain was preserved in China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), taxonomic name: Bifidus lactis Bacillus (Bifidobacterium lactis); the deposit number is CGMCC No.15650.
[0044] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99
[0045] Physical and chemical test results:
[0046]
[0047] 16S rRNA gene sequence sequencing results (SEQ ID No.1):
[0048] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGC...
Embodiment 2
[0062] Example 2: Ovariectomized Rat Animal Model and Probiotic Intervention
[0063] After culturing Bifidobacterium lactis BL-99 in MRS liquid medium at 37°C for 16 hours, centrifuge at 4°C and 2500rpm for 10 minutes to collect the bacteria, wash with phosphate buffered saline (PBS) and freeze-dry at -18°C Save below. Used in the experimental research of Embodiment 2-Embodiment 5 of the present invention.
[0064] Eighty-five 17-week-old female adult SD rats, weighing 200-300g. Rats were randomly divided into 3 groups, 10 in each group. Twenty rats underwent ovariectomy, and the remaining 10 rats underwent sham surgery. The rats had 12 hours of light / dark per day, the room temperature was around 25°C, and they had free access to drinking water. After 12 weeks of surgical intervention, the animals in the model observation group were sacrificed, and samples such as uterus, femur, and tibia were collected, and related indicators of osteoporosis, such as uterine coefficient,...
Embodiment 3
[0070] Example 3: Bone Histomorphometry Measurements
[0071] Take the proximal 1 / 3 of the left tibia, cut it longitudinally along the sagittal plane, and take about 1×0.5×0.5cm 3 , soak in decalcification solution 10% EDTA / PBS (pH7.4) until complete decalcification, about 1 week, change the solution every 3 days, then routine dehydration, paraffin embedding, along the sagittal plane (thickness 4μm) , HE staining, and the pathological image analyzer can be used to measure the total tissue area, trabecular bone area, and total perimeter of trabecular bone, and then use the calculation formula to convert the percentage of trabecular bone area, number of trabecular bone, trabecular bone thickness and bone Trabecular separation. Bone tissue slices were also used to observe the appearance, arrangement, and morphological integrity of bone trabeculae.
[0072] After 12 weeks of probiotic BL-99 intervention, HE staining results ( Figure 2A ), the trabeculae in the sham operation g...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com