Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant pichia pastoris engineering bacterium containing high-copy-number humanized lysozyme gene and application thereof

A Pichia pastoris, copy number technology, applied to recombinant Pichia pastoris engineering bacteria containing a high copy number human lysozyme gene and its application field, can solve problems such as unfavorable large-scale production and application, high cost, small scale, etc. question

Inactive Publication Date: 2020-03-24
ZHEJIANG SILVER ELEPHANT BIO ENG +1
View PDF27 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this direct extraction production method is small in scale and high in cost, which is not conducive to large-scale production and application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant pichia pastoris engineering bacterium containing high-copy-number humanized lysozyme gene and application thereof
  • Recombinant pichia pastoris engineering bacterium containing high-copy-number humanized lysozyme gene and application thereof
  • Recombinant pichia pastoris engineering bacterium containing high-copy-number humanized lysozyme gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Artificial synthesis of human lysozyme gene hlyz derived from Homo sapiens and construction of pPIC9K-hlyz plasmid

[0046] According to the NCBI database GenBank Protein ID P61626 Homo sapiens-derived human lysozyme amino acid sequence (SEQ ID NO. 1), and Wuxi Huada Qinglan Biotechnology Co., Ltd. carried out gene synthesis, and cloned the gene between EcoRI and NotI of pPIC9K to obtain recombinant plasmid pPIC9K-hlyz, such as figure 1 shown. Transform it into E.coli DH5α strain to obtain E.coli DH5α(pPIC9K-hlyz) recombinant strain.

Embodiment 2

[0047] Example 2 Constructing Pichia pastoris recombinant bacteria expressing human lysozyme in secreted form

[0048] After the linearized pPIC9K-hlyz plasmid was transformed into Pichia pastoris GS115, the resistant strains were screened on a high-concentration G418 plate, and then the strains with high production of human lysozyme were screened on a lysozyme plate, and finally obtained by a Erlenmeyer flask shake flask experiment The Pichia pastoris recombinant strain that secretes and expresses human source lysozyme, the specific embodiment is as follows:

[0049] ① Linearize the pPIC9K-hlyz plasmid. The strain E.coli DH5α (pPIC9K-hlyz) was inoculated into LB medium containing 100 μg / mL ampicillin, cultured overnight at 37°C, and the pPIC9K-hlyz plasmid was extracted using a plasmid extraction kit; the restriction enzyme SacI was used to Cut the plasmid pPIC9K-hlyz to make it linearized, and perform gel recovery on the digested product, and purify the linearized plasmid a...

Embodiment 3

[0076] Example 3 Construction of recombinant plasmid pPICZα-hlyzV with multiple copies of human lysozyme

[0077] Based on the pPICZαA plasmid, after 5 steps of assembly, the recombinant plasmid pPICZα-hlyzV containing 5 copies of the reading frame of the human lysozyme gene was constructed, such as figure 2 As shown, the specific operation method is as follows:

[0078] ①Clone hlyz-TT between the EcoRI and BsmBI of pPICZαA to obtain the recombinant plasmid pPICZα-hlyzTT, the specific operation is as follows: first extract the pPICZαA plasmid, perform double enzyme digestion with EcoRI and BsmBI, and gel recovery and purification; use primer hlyzTT-1 -F: gagaaaagagaggctgaagctgaattcaaggtctttgagagatgcga and hlyzTT-1-R: CTCGAGGTACCGATCCGAGACGACTTCTCACTTAATCTTCTGTAC, using the plasmid pPIC9k-hlyz as the DNA template, using the high-efficiency enzyme Phanta MaxSuper-Fidelity DNA Polymer from Vazyme Biotech Co., Ltd. Perform PCR amplification to obtain the hlyz-TT fragment, gel re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant pichia pastoris engineering bacterium containing a high-copy-number humanized lysozyme gene and application thereof. The recombinant pichia pastoris engineering bacterium is obtained by integrating a lysozyme gene shown in SEQ ID NO.1 with a pichia pastoris genome with a high copy number. According to the invention, a two-plasmid-mediated recombinant bacteriumconstruction method is adopted to obtain a recombinant bacterium with a copy number of 15; and the lysozyme produced by the recombinant bacterium has high enzyme activity, and the fermentation enzymeactivity is 180-220 KU / mL within 120-140h.

Description

[0001] (1) Technical field [0002] The invention relates to a recombinant Pichia pastoris containing a high-copy number human lysozyme gene and its application in fermenting and producing human lysozyme. [0003] (2) Background technology [0004] Lysozyme is an effective antibacterial agent that specifically acts on the cell wall, destroys the β-1,4-glycosidic bond between N-acetylglucosamine and N-acetylmuramic acid in the cell wall, and decomposes insoluble mucopolysaccharides into soluble sugars Peptide, with bacteriolytic effect. Lysozyme has a wide range of sources in nature, and can be divided into four types of lysozymes: microorganisms, bacteriophages, plants and animals. Among them, animal lysozymes have high activity and are widely used. In 1992, the Food Additives Association of FAO / WTO announced that lysozyme is safe to be used in the food industry, and the Ministry of Health of my country issued the No. 23 Announcement in 2010 to approve substances such as lysoz...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N9/36C12N15/81C12R1/84
CPCC12N9/2462C12N15/815C12N2800/22C12Y302/01017
Inventor 陈小龙周斌朱林江陈艺强陆跃乐朱勇刚陈翰驰
Owner ZHEJIANG SILVER ELEPHANT BIO ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com