Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

K-ras gene mutation site detection kit

A detection kit, 1.k-ras technology, applied in the fields of molecular biotechnology and gene detection, can solve the problems of high operator requirements, high cost of kits, and difficulty in mutating genes, and achieve low-cost detection and detection. High efficiency and avoid cross-contamination effect

Active Publication Date: 2020-02-25
广州市宝创生物技术有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, under normal circumstances, in actual clinical samples, the mutated gene is usually mixed with a large number of wild-type gene sequences, and because the sequences between the two are often only one base difference, it is very difficult to detect the mutated gene in a targeted manner
Based on this, at present, the detection of such genetic loci is mostly based on molecular detection methods with high specificity, and the most used technology platforms are ARMS technology and NGS technology, both of which can detect as low as about 1%. However, due to the higher cost of the kit (or higher requirements for the operator), it brings a greater economic burden to the patient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • K-ras gene mutation site detection kit
  • K-ras gene mutation site detection kit
  • K-ras gene mutation site detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The primer probe that embodiment 1 K-ras gene mutation site detection uses

[0050] Design specific primers and probes according to the sequence of the hot spot mutation site (as shown in Table 1) on exon 12 and 13 of the K-ras gene, and the specificity of the detection results can be determined jointly by the primer pair and the probe pair. Design principles such as figure 1 shown.

[0051] Table 1. Common K-ras gene hotspot mutation types

[0052]

[0053] The K-ras gene mutation site detection kit consists of primers, conventional probes, nano gold probes, reaction solution and enzyme solution, and the sequences of the primers and probes are as follows.

[0054] Upstream primer: GTA CTG GTG GAG TAT TTG ATA GTG TAT TAA CCT TAT G (SEQ ID NO: 1);

[0055] Downstream primer: TGG TCC TGC ACC AGT AAT ATG CAT ATT AAA ACA AG (SEQ ID NO: 2);

[0056] Upstream probe: GGACACCGCATGGC (SEQ ID NO: 3);

[0057] Downstream probe 1: CACCGCATGGCTCACCAGCTCCAACTAC (SEQ ID NO: 4)...

Embodiment 2

[0067] Example 2 Verification of independent detection results of seven mutation sites of K-ras gene

[0068] In this embodiment, the K-ras gene mutation site detection kit described above is used to detect Templates with different K-ras gene percentage mutation content are used to verify the feasibility of a single independent detection system.

[0069] The reaction volume of the kit is 20 μL, and its components are: 10 mM Tris buffer (pH 8.5), 1 μM primers (upstream primers, downstream primers), 1 μM probes (upstream probes, downstream probes 1-7, hair clip probe), 0.1 μM nano-gold probe (nano-gold probe 1, nano-gold probe 2), 0.2 mM dNTP, 0.5 U Taq DNA polymerase and endonuclease AfuFEN. The specific mutation templates to be tested are respectively added to the corresponding detection systems in the mixing ratios of 50%, 10%, 2%, 1%, 0.5%, 0.2%, 0.1%, 0.05%, and 0%. Perform negative (NC) and positive (PC) quality control at the same time, and the reaction program is: 95°C...

Embodiment 3

[0070] Example 3 Verification of the same tube detection results of seven mutation sites of K-ras gene

[0071] This embodiment uses the K-ras gene mutation site detection kit described above, using a pair of primers, probe 1, nano-gold probe, reaction solution, enzyme solution, probe 2-probe 8, etc. to detect different The template of K-ras gene percentage mutation content is used to verify the feasibility of multiplex detection for detecting multiple mutation sites in a single reaction system.

[0072] The reaction volume of the kit is 20 μL, and its components are: 10 mM Tris buffer (pH 8.5), 1 μM primers (upstream primers, downstream primers), 1 μM probes (upstream probes, downstream probes 1-7, hair clip probe), 0.1 μM nano-gold probe (nano-gold probe 1, nano-gold probe 2), 0.2 mM dNTP, 0.5 U Taq DNA polymerase and endonuclease AfuFEN. The specific mutation templates to be tested are respectively added to the corresponding detection systems in the mixing proportions of 5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
particle sizeaaaaaaaaaa
particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of molecular biotechnology and gene detection, in particular to a K-ras gene mutation site detection kit, comprising: a), a primer pair; b), an upstream probe, downstream probes, and a hairpin probe; and c), two nanogold probes. The above-mentioned primers and probes are suitable for carrying out high-sensitivity high-resolution low-cost detection on K-ras gene mutation sites under closed tube condition, so that cross contaminations to amplification products can be effectively avoided can be effectively avoided, wherein the downstream probes are suitable forindividual use and also for use with each other to carry out multiple detection in a same reaction system, so that the kit herein is suitable for detecting up to seven K-ras gene mutation sites at thesame time, and the detection efficiency is higher.

Description

technical field [0001] The invention relates to the fields of molecular biotechnology and gene detection, in particular to a K-ras gene mutation site detection kit. Background technique [0002] K-ras is a small molecular G protein downstream of the EGFR signaling pathway. After mutation, its own GTPase activity is inhibited, so that the K-ras protein is always activated, and the signaling pathway is not regulated by the upstream EGFR signaling instructions. The mutation rate of K-ras gene in patients with colorectal cancer is about 40%, 70% occurs in the 12th codon, and 30% occurs in the 13th codon. K-ras gene mutation status is related to the curative effect of cetuximab, and cetuximab treatment is ineffective when K-ras gene mutation occurs. Drug regimen is very necessary. However, under normal circumstances, in actual clinical samples, the mutated gene is usually mixed with a large number of wild-type gene sequences, and because the sequences between the two are often ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6827C12N15/11
CPCC12Q1/6827C12Q2563/137C12Q2563/155
Inventor 王建平
Owner 广州市宝创生物技术有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More