Cloning and application of tobacco neonicotinoid synthesis regulation gene NtERF91
A technology for regulating genes and neonicotinoids, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Embodiment 1—the isolation and cloning of NtERF91 gene, comprises the following steps:
[0061] 1. Determine the NtERF91 gene sequence:
[0062] By analyzing the transcriptome data of tobacco root tissues treated with jasmonin, one ERF family gene positively regulated by jasmonin was obtained, and sequence alignment revealed that the gene was NtERF91. Design gene cloning primers according to this gene sequence and carry out PCR reaction, obtain target product; Forward primer NtERF91-BamH I:
[0063] GGATCC ATGTTAACTAGTGTCAATACCACGT;
[0064] Reverse primer NtERF91-Xho I: CTCGAG TCAATTTTCAGCCAATTTTCTCTTC; in order to construct the overexpression vector, the primer restriction sites (underlined) BamH I and Xho I in the above primers;
[0065] 2. Use the Trizol kit (Invitrogen) to extract RNA from the roots of tobacco variety Coker176, and operate according to the instructions provided by the kit.
[0066] 3. Using the first-strand cDNA obtained by reverse transcript...
Embodiment 2
[0071] Overexpression vector construction
[0072] 1. The cloned NtERF91 was connected to the TOPO vector
[0073] (1) Using the cDNA of the root of the tobacco variety Coker176 as a template, using NtERF91 gene-specific primers to amplify, obtain a gene fragment with a size of about 0.5 kb, purify and recover;
[0074] (2) TOPO clone the recovered NtERF91 gene fragment, connect to -BluntⅡ-TOPO (3.5kb) vector was used to transform Escherichia coli DH5α competent cells, the plasmid was extracted for PCR detection, and the plasmid with amplified product size of about 0.5kb was selected to extract DNA, and the constructed vector was named pTOPO-NtERF91;
[0075] (3) Since the forward and reverse primers of the gene have recognition sites of BamH I and Xho I respectively, these two enzymes were selected for double-enzyme digestion detection on the plasmid DNA sample, and two fragments were produced as a result of the enzyme digestion, with a size of 3.5 kb and 0.5kb, indicating...
Embodiment 3
[0084] genetic transformation of tobacco
[0085] (1) Transformation of expression vector into Agrobacterium
[0086] Take out the Agrobacterium competent cells from the -80°C refrigerator, place them on ice to dissolve, and add 4 μL of the recombinant expression vector pK2GW7-NtERF91; quick-freeze in liquid nitrogen for 1 minute, transfer to a 37°C water bath for 5 minutes, and then ice-bath for 2 minutes, add to the mixture Add 1mL LB liquid medium, culture at 28°C and 220rpm for 3-4 hours; spread the culture on LB solid medium containing spectinomycin 100mg / L and rifampicin 25mg / L, and incubate at 28°C for 2-3 hours Days, Agrobacterium clones containing the target vector can be seen;
[0087] (2) Tobacco Transformation
[0088] a. Pick the Agrobacterium clone containing the target vector, streak it on an LB plate containing spectinomycin and rifampicin, and culture it at 28°C for 2-3 days; scrape the streaked plaque and inoculate it on a plate containing spectinomycin and...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com