Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Kit and detection method for detecting EGFR gene T790M mutation

A technology of T790M-F and T790M-R is applied in the field of kits for detecting EGFR gene T790M mutation, which can solve the problems of long detection time, complicated procedures and high detection cost, and achieve the effect of reducing detection time and cost.

Inactive Publication Date: 2019-12-27
张鸿
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the traditional detection of the EGFR gene T790M mutation frequency with complex procedures, long detection time and high detection cost, in practice, it is only necessary to detect whether the T790M drug-resistant mutation occurs in the EGFR gene in clinical practice, and it is not necessary to know the mutation frequency accurately. The present invention provides a kit and detection method for detecting the T790M mutation of the EGFR gene, which can quickly judge whether the T790M mutation occurs in the EGFR gene in the blood DNA, and know the frequency range of the gene mutation, so as to provide accurate scientific basis for the doctor's diagnosis. Reduced inspection time and cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and detection method for detecting EGFR gene T790M mutation
  • Kit and detection method for detecting EGFR gene T790M mutation
  • Kit and detection method for detecting EGFR gene T790M mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] This embodiment provides a kit for detecting the T790M mutation of the EGFR gene, including an isothermal amplification reaction system, a detection reaction system, and a ctDNA standard product with known T790M mutation frequency of the EGFR gene.

[0056] The isothermal amplification reaction system comprises:

[0057] The isothermal amplification reaction system includes: T790M site detection primers, Rehydration Buffer, MgA C and RPA lyophilized enzyme;

[0058] Wherein, the T790M site detection primers include primer T790M-F and primer T790M-R:

[0059] The base sequence of the primer T790M-F is as follows:

[0060] GAAATTAATACGACTCACTATAGGGCATCTGCCTCACCTCCACCGTGCAGCTCATC.

[0061] The base sequence of the primer T790M-R is as follows:

[0062] TTCCCGGACATAGTCCAGGAGGCAGCCGAAGGGC.

[0063] The detection reaction system includes: Cas13a Enzyme Mix, detection mutant probe, dNTP Mix, T7 RNAPolymerase Mix and MgCl 2 .

[0064] The detection mutant probe is T790MP...

Embodiment 2

[0082] This embodiment provides a kit for detecting the T790M mutation of the EGFR gene, including an isothermal amplification reaction system, a detection reaction system, and a ctDNA standard product with known T790M mutation frequency of the EGFR gene.

[0083] T790M site detection primer, Rehydration Buffer, MgA C and RPA lyophilized enzyme;

[0084] Wherein, the T790M site detection primers include primer T790M-F and primer T790M-R:

[0085] The base sequence of the primer T790M-F is as follows:

[0086] GAAATTAATACGACTCACTATAGGGCATCTGCCTCACCTCCACCGTGCAGCTCATC.

[0087] The base sequence of the primer T790M-R is as follows:

[0088] TTCCCGGACATAGTCCAGGAGGCAGCCGAAGGGC.

[0089] The detection reaction system includes: Cas13a Enzyme Mix, detection mutant probe, dNTP Mix, T7 RNAPolymerase Mix and MgCl 2 .

[0090] The detection mutant probe is T790MProbe, and the base sequence of the T790MProbe is:

[0091] TAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACGCATCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a kit for detecting EGFR gene T790M mutation and a gene mutation detection method based on the kit, and relates to the technical field of gene detection. The kit comprises an isothermal amplification reaction system, a detection reaction system and at least two circulating tumor DNA standards with known mutation frequencies of an EGFR gene T790M. The kit has the characteristics of being high in sensitivity, high in specificity, simple in operation, easy to carry and the like, and is very suitable for detection of low-frequency mutations in tumor DNA molecules. The detection sensitivity of the detection method based on the kit can reach 10-18 moles per liter, that is the mole level, and the specificity can be achieved by identifying the differences in nucleic acid fragments of a single basic group.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a kit for detecting EGFR gene T790M mutation. Background technique [0002] At present, the T790M mutation on exon 20 is the most common gene mutation. Therefore, the third-generation TKI, represented by Osimertinib, has emerged for this mutation, and the detection of T790M mutation is becoming more and more popular. There is an urgent need for a simple and rapid method for detecting the T790M mutation. [0003] At present, there are several diagnostic platforms based on PCR detection for EGFR mutation detection, including cobas method, ARMS method, BEAMing method, digital PCR method, HRM method, DHPLC method, mass spectrometry genotyping, electric field induced release and measurement method (EFIRM) and next-generation sequencing (NGS). [0004] The rapid detection of nucleic acid data with high sensitivity and single base specificity is helpful for the detection of var...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6844
CPCC12Q1/6844C12Q1/6883C12Q2600/156C12Q2563/107C12Q2522/101C12Q2565/625
Inventor 张鸿聂志超徐子静
Owner 张鸿
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com