Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group for identifying avian adenovirus type 4 and chicken infectious anemia virus and application of primer group

A technology for chicken infectious anemia and poultry adenovirus, applied in the direction of microorganisms, recombinant DNA technology, and methods based on microorganisms

Inactive Publication Date: 2019-12-13
GUANGXI VETERINARY RES INST
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Compared with conventional PCR, multiplex PCR has the characteristics of simultaneous detection and identification of multiple pathogens, and has unique advantages and high clinical practical value in the differential diagnosis of mixed infection of multiple pathogens. However, there is no rapid differential diagnosis at present. Multiplex PCR detection method for FadV-4 and CIAV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for identifying avian adenovirus type 4 and chicken infectious anemia virus and application of primer group
  • Primer group for identifying avian adenovirus type 4 and chicken infectious anemia virus and application of primer group
  • Primer group for identifying avian adenovirus type 4 and chicken infectious anemia virus and application of primer group

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1, primer design

[0029] A large number of sequence analyzes and comparisons were carried out to obtain several primers for identifying avian adenovirus type 4 and several primers for identifying chicken infectious anemia virus. Preliminary experiments were carried out on each primer to compare the performance of sensitivity and specificity, and finally the primer pair Ⅰ and primer pair Ⅱ for identifying avian adenovirus type 4 and chicken infectious anemia virus were obtained.

[0030]The specific primer pair (primer pair I for short) used to identify avian adenovirus type 4 consists of the following two primers (5'→3'):

[0031] FadV-4F (SEQ.ID.NO.1): TTCGCCAAGTCTCAGTACAAT;

[0032] FadV-4R (SEQ.ID.NO.2): GGAGTCGTGATACAGCAGGTT;

[0033] The specific primer pair (primer pair II for short) for identifying chicken infectious anemia virus consists of the following two primers (5'→3'):

[0034] CIAV-F (SEQ.ID.NO.3): CGACATCGGAGGAGACAGA;

[0035] CIAV-R (SEQ...

Embodiment 2

[0037] Embodiment 2, double PCR reaction condition optimization

[0038] 1. Template preparation

[0039] 1. Genomic DNA of avian adenovirus type 4 was extracted to obtain sample A.

[0040] 2. Extract the DNA of chicken infectious anemia virus to obtain sample B.

[0041] 3. Mix sample A and sample B to obtain a mixed sample.

[0042] 2. Optimization of primer concentration

[0043] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR.

[0044] Double PCR reaction system (25.0 μL): Contains 12.5 μL of 2×PCR Mix, 2.0 μL of the mixed sample obtained in step 1 (in the 2.0 μL mixed sample, the genomic DNA content of avian adenovirus type 4 is 1.0 ng, and chickens infected The DNA content of anemia virus is 1.0ng), primer pair Ⅰ and primer pair Ⅱ, finally use ddH 2 O to make up to 25.0 μL.

[0045] According to the concentration of primer pair I and primer pair II in the reaction system, set up 8 d...

Embodiment 3

[0074] Embodiment 3, specificity

[0075] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: avian adenovirus type 1-12 (FadV1-12), chicken infectious anemia virus (CIAV), chicken parvovirus (ChPV), Marek virus (MDV), infectious laryngotracheitis virus (ILTV) .

[0076] 2. Extract the total RNA of the sample to be tested and reverse transcribe it into cDNA. The samples to be tested are: avian nephritis virus (ANV), Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIV-H9), and infectious bronchitis virus (IBV).

[0077] 3. Use each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of embodiment 2 as templates, and perform double PCR using the primer combination prepared in embodiment 1.

[0078] Reaction system for double PCR (25.0 μL): 12.5 μL of 2×PCR Mix, 2.0 μL of template, primer pair I and primer pair II, and ddH 2 O to make up to 25.0 μL. In the reacti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group for identifying avian adenovirus type 4 and a chicken infectious anemia virus. The primer group comprises a primer pair I and a primer pair II; the primer pair Iconsists of a primer FadV-4 F and a primer FadV-4R; the primer pair II consists of a primer CIAV-F and a primer CIAV-R; the primers FadV-4F, FadV-4R, CIAV-F and CIAV-R have base sequences of SEQ. ID. NO. 1 to SEQ. ID. NO. 4 respectively. Accordingly, an inventor further establishes a corresponding detection and identification method and develops a corresponding kit. Established double PCR can beused for rapidly detecting mixed infection of the avian adenovirus type 4 and the chicken infectious anemia virus, is suitable for mass detection, can save the cost and the time, can further reduce pollution and has very high practical value.

Description

technical field [0001] The invention belongs to the technical field of detecting poultry adenovirus type 4 and chicken infectious anemia virus, and in particular relates to a primer set for identifying poultry adenovirus type 4 and chicken infectious anemia virus and its application. Background technique [0002] Adenovirus type 4 (FadV-4) is a non-enveloped double-stranded DNA virus. Since the second half of 2015, Shandong, Jiangsu, Henan, Hebei, Liaoning, Jilin, Anhui, Zhejiang, Hubei and Shanxi An acute infectious disease characterized by pericardial effusion and hepatosplenomegaly has occurred in chicken flocks in other places. The disease can cause high infectivity and high mortality. Infecting 3-5 week-old chickens can lead to sudden death, death rate as high as 80%. The disease has no obvious clinical symptoms, and individual chickens have clinical manifestations such as depression and curly feathers before death. The lesions of the autopsy of the dead chickens are ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2537/143C12Q2565/125
Inventor 谢芝勋张艳芳邓显文刘加波谢志勤张民秀谢丽基罗思思曾婷婷
Owner GUANGXI VETERINARY RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com