Primer and probe combination for human apolipoprotein E (ApoE) gene typing, and using method of primer and probe combination
A primer probe and genotyping technology, applied in the field of genes, can solve the problems of missed and wrongly detected primer probe design, complex detection results judgment, multiple amplification primers, etc., to enhance sensitivity and specificity, and result interpretation. Simple and clear, the effect of reducing the cost of use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1.ApoE genotyping primer probe design
[0060] 1) ApoE gene sequence
[0061] The human ApoE gene is located on chromosome 19 of the genome. For the genomic DNA sequence of the ApoE gene, see NC_000019.10:44905749-44909395. The full-length cDNA sequence (Genebank NM_001302688.1) encoding the wild-type ApoE3 gene is shown in SEQ ID No:1.
[0062] SEQ ID No: 1
[0063]GGGACAGGGGGAGCCCTATAATTGGACAAGTCTGGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGGTGAGAAGCGCAGTCGGGGGCACGGGGATGAGCTCAGGGGCCTCTAGAAAGAGCTGGGACCCTGGGAACCCCTGGCCTCCAGACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAG...
Embodiment 2
[0087] Embodiment 2. Application of ApoE genotyping reagent to the typing detection of samples
[0088] (1) Test samples: The test samples are DNA samples from the blood of healthy people.
[0089] Blood DNA samples were extracted using Tiangen Blood Genomic DNA Extraction Kit, and 0.5ml of blood was taken from each sample, and extracted according to the requirements of the kit instructions.
[0090] The concentration of the nucleic acid sample was measured with an Eppendorf ultraviolet spectrophotometer to control the quality of DNA extraction OD260 / 280≧1.8.
[0091] (2) Reaction system
[0092] The reaction system includes 1×Premix Taq™ Hot Start (TakaraBio Inc, R028A) for each assay reaction mixture (25 μl). Two independent reaction systems are used to detect two possible point mutation types of ApoE2 and ApoE4 respectively. The two reaction systems The reaction components and their concentrations are shown in Table 6 and Table 7.
[0093] Table 6. ApoE2 typing reagent c...
Embodiment 3
[0106] Example 3. Comparison of ApoE genotyping detection and sequencing results
[0107] In this example, ApoE genotyping was detected in blood gDNA samples of 8 healthy volunteers by using the primer-probe combination reagent and the sequencing method of the present invention respectively. The DNA extraction method of the blood sample was as described above. Refer to Example 2 for the method of using the detection reagent. The test results of the 8 samples are shown in Table 10. and sequencing test results (see figure 1 ) consistent, indicating that the ApoE typing reagent of the present invention has higher detection accuracy.
[0108] Table 10. ApoE genotype detection of 8 healthy people
[0109]
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com