Adelphocoris suturalis reproduction related protein PG, and coding gene, dsRNA interference sequence and application thereof
A technology of Lygus melanogaster and interference sequence, which is applied in the field of agricultural biology and can solve the problems such as the unreported role of pepsinogen
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Cloning and Analysis of the Lygus pepsinogen Gene in Example 1
[0030] Weigh 30 mg of Lygus melanogaster samples into 1.5 ml enzyme-free tubes, pre-cool with liquid nitrogen, grind the females with a grinding rod, and extract total RNA using the TRIzol method.
[0031] The total RNA extracted above was synthesized into a cDNA template using the PrimeScriptTM RT Master Mix (perfect real time) kit.
[0032] The primers designed and synthesized are as follows:
[0033] Upstream primer sequence PG-F: 5'-TGATCTAAGTGTGATCAGTAAAGATGATTT-3',
[0034] Downstream primer sequence PG-R: 5'-GTTCCATAAAGTATTTAATTCGCTAAAGTCG-3'.
[0035] Using the cDNA of Lygus melanogaster as a template, PCR amplification was carried out using the above primers PG-F and PG-R. 1% agarose electrophoresis to detect PCR products, ethidium bromide (EB) staining, observe the electrophoresis results under ultraviolet light, detect the correct fragments, and use the DNA gel recovery kit to purify and recove...
Embodiment 2
[0038] Example 2 Silencing efficiency of the gene after injection of dsRNA of the pepsinogen gene and its influence on the fecundity of Lygus melanogaster
[0039] 2.1 Preparation of dsRNA template
[0040] According to the pepsinogen gene sequence obtained in Example 1, design specific amplification primers (5'-end plus T7 promoter sequence), for the amplification of the dsRNA fragment of pepsinogen gene, the specific primers of design are as follows:
[0041] Upstream primer sequence dsPG-F: CCCGAACAACTGTGGTGGAA
[0042] Downstream primer sequence dsPG-R: TTGGCTTGGCGATCCAAAATC.
[0043] Using the cDNA of Lygus melanogaster as a template, PCR amplification was carried out using the above primers dsPG-F and dsPG-F, the PCR product was detected by 1% agarose electrophoresis, stained with ethidium bromide (EB), and the electrophoresis results were observed under ultraviolet light. Gel and use the DNA gel extraction kit to purify and recover the target fragment. The PCR produc...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular mass | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap