Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of SNP molecular marker related to the number of glandular gastric papilla in chicken and its application

A technology of molecular markers and nipples, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., can solve problems such as the selection of glandular and gastric papillae, increase the number of glandular and gastric papillae, reduce feeding costs, and increase production benefit effect

Active Publication Date: 2020-12-01
JIANGSU INST OF POULTRY SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, breeding chicken breeds or strains with a large number of glandular teats will be the most effective way to improve feed conversion rate. However, the number of glandular gastric teats has not been selected in production at present, and there is no application of relevant molecular markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of SNP molecular marker related to the number of glandular gastric papilla in chicken and its application
  • A kind of SNP molecular marker related to the number of glandular gastric papilla in chicken and its application
  • A kind of SNP molecular marker related to the number of glandular gastric papilla in chicken and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Genome-wide association analysis

[0036] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / μl for genotyping.

[0037] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10 -6 SNP markers; BEAGLE v4.0 selects R 2 SNPs >0.5 were filled. Quality control left 435867 SNPs and 1252 samples for subsequent analysis.

[0038] (3) Genome-wide association study (GWAS) metho...

Embodiment 2

[0040] The establishment of the allele detection method of the number of glandular gastric papilla in embodiment 2

[0041] (1) Amplify a 220bp nucleotide fragment on chromosome 3 with primers for the target fragment of the SNP marker site significantly related to the number of gastric papillae. The upstream and downstream primers for sequence amplification are:

[0042] Upstream primer xian-F: ACCTCGTCTGCTGTCCATAG (SEQ ID NO.1)

[0043] Downstream primer xian-R: GCCTGTTTAATGTGCTCCCA (SEQ ID NO.2)

[0044] (2) PCR amplification:

[0045] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.

[0046] Using the obtained C3 strain chicken genomic DNA as a template, PCR amplification was performed using primers xian-F and xian-R.

[0047] The amplification system is as follows:

[0048]

[0049] The PCR reaction procedure is as follows:

[0050]

[0051] (3) Sequence s...

Embodiment 3

[0056] Example 3 Effect Analysis of Molecular Marker SNP rs312759222 Mutation

[0057] A SNP molecular marker that improves the number of chicken glandular papillae provided by the present invention, the glandular glandular papillae number of CC and TT genotype is more, the glandular gastric papillae number of CT genotype is less, such as figure 2 As shown, therefore, individuals with CC and TT homozygous genotypes were selected during the subculture selection process, and individuals with CT heterozygous genotypes were eliminated.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP molecular marker relating to the number of chicken glandular stomach nipples, and belongs to the field of molecular marker and genetic breeding. An SNP bit point in themolecular marker is located at 19459654 of a third chromosome of an international chicken reference genome GRCg6a Primary Assembly edition, and a basic group at the position is C or T. The invention further provides a primer combination for detecting the SNP molecular marker relating to the number of the chicken glandular stomach nipples and application of the primer combination. By using theSNP molecular marker and the primer combination, an efficient and accurate molecular marker assistant breeding method for the number of the glandular stomach nipples can be built, so that a breeding method of the number of the glandular stomach nipples is effectively initiated, the feed conservation ratio is improved, and development of Chinese chicken raising industry is promoted.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker related to the number of papillae in the glandular stomach of chickens and an application thereof. Background technique [0002] With population growth, income growth, and urbanization, the chicken industry is doing well. At present, the biggest problem facing poultry farming is the relative lack of feed resources. How to improve the feed conversion rate and promote the sustainable and healthy development of the poultry farming industry under the premise of ensuring the quality of chicken eggs is currently the focus of attention. It is difficult to record and count the feed consumption of individual chickens in production, and it is difficult to effectively select the feed conversion rate in breeding practice, which limits the development of the chicken industry. The use of indirect trait indicators or molecular markers is an effectiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 王克华曲亮沈曼曼卢建郭军李尚民窦套存马猛李永峰胡玉萍王星果
Owner JIANGSU INST OF POULTRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com