Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR

A Chikungunya virus, real-time fluorescence quantitative technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganism measurement/testing, etc., can solve the problems of low sensitivity and long time required, and achieve high sensitivity High performance and specificity, easy operation, low pollution effect

Active Publication Date: 2019-10-08
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Virus isolation is the gold standard for laboratory confirmation, but it takes a long time and has low sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR
  • Method for detecting Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR
  • Method for detecting Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The design of specific primers and probes of embodiment 1 Zika virus, Chikungunya virus and Mayaro virus

[0058] 1. Design and screening of primers and probes

[0059] The genome sequences of Zika virus, Chikungunya virus and Mayaro virus were searched and downloaded in the NCBI database (https: / / www.ncbi.nlm.nih.gov / taxonomy). Select a more complete viral genome sequence with a clearer isolation date and region, a genome sequence of a marked standard strain, and a virus genome sequence with a clear genotype. Evaluate whether the direction of the viral genome sequence needs to be corrected, remove individual N-base sequences of poor quality, consult relevant entry information, and determine the sequence inclusion criteria as having clear virus isolation age, region and other information. Save the sequence file in FASTA format, use the Clustal W analysis module embedded in the software to perform overall comparison analysis, and determine the classification of each gen...

Embodiment 2 3

[0080] Example 2 Establishment of a detection method for simultaneous detection of Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR

[0081] 1. Extraction of virus nucleic acid to be tested

[0082] The cell culture supernatant of the virus to be tested was collected, and the viral nucleic acid was extracted using the QIAamp Viral RNA Mini Kit.

[0083] 2. Preparation of positive control standard

[0084] For the Mayaro virus, by synthesizing the conserved region of the Mayaro virus gene (as shown in SEQ ID NO.12) as a positive control standard, the synthetic target gene is cloned into the pET-28a(+) vector, and the gene synthesis Cloning with plasmids was done by Beijing Tianyi Huiyuan Biological Company. The target gene contained in the cloning plasmid was amplified by ordinary PCR with 2×PCR Mix reagent from Thermo Company. The upstream primer of the amplification was TAATACGACTCACTATAGGGCAAGT (SEQ ID NO.13), and the downs...

Embodiment 3 3

[0096] The specificity analysis of embodiment 3 triple real-time fluorescent quantitative RT-PCR detection method

[0097] With Zika virus, Chikungunya virus RNA and Mayaro virus RNA standards synthesized in vitro as positive controls, dengue Ⅰ-Ⅳ, Seoul virus, Hantaan virus, fever with thrombocytopenia syndrome Buney The subvirus was used as a control virus, and the specificity analysis was performed on the detection method provided in Example 2. The cell culture supernatants of Zika virus, Chikungunya virus, and each control virus were collected, and viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit.

[0098] Adopt the detection method of embodiment 2 to carry out real-time fluorescent quantitative RT-PCR detection, concrete treatment group design is as follows: RNA standard product (concentration: 1×10 8 copies / uL) was used as a positive control; the simulated samples infected with other viruses were composed of RNA from 7 viruses including Dengue Ⅰ-Ⅳ,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of virus detection, and concretely relates to a method for detecting Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR. The method combines the probability of occurrence of related mosquito-borne pathogens, the risk of prevalence, and the operability of a laboratory testing procedure, the Mayaro virus isused to replace the dengue virus in an existing common combination detection scheme, and a new detection scheme using Zika virus, Chikungunya virus and Mayaro virus as detection targets is formed. Theinvention provides a specific primer, a probe and a triple real-time quantitative RT-PCR detection method for simultaneously identifying the viral pathogens Zika virus, Chikungunya virus and Mayaro virus which are transmitted by Aedes mosquito and cause similar clinical symptoms of diseases. The method has high specificity and sensitivity, good repeatability, simple and rapid detection, and costsaving, and can complement a traditional detection scheme and has high application value.

Description

technical field [0001] The invention relates to the technical field of virus detection, in particular to specific primers and probes for simultaneous detection of Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR. A method and kit for simultaneous detection of Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR with primers and probes. Background technique [0002] Mosquito-borne viral diseases, especially those transmitted by Aedes mosquitoes, are the most serious infectious diseases in the world. The diseases caused mainly include dengue fever, Zika virus disease, chikungunya fever and Mayaro virus disease, etc. extensive attention. [0003] Zika virus (ZIKV) belongs to the family Flaviviridae, the genus Flaviviruses, and its diameter is about 42-52nm. It is an enveloped single-stranded RNA virus with a genome length of about 10.7kb. Contains a single open reading frame (Open ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2600/16C12Q2537/143C12Q2531/113C12Q2561/113C12Q2521/107Y02A50/30
Inventor 李建东赖丽金张全福李阿茜梁米芳李德新孙丽娜王芹尚翠李川
Owner STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com