Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe and detection method for detecting cryptosporidium by RAA fluorescence method

A technology of cryptosporidium and fluorescence method, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of long time, inconvenient operation, large error, etc. Effects of cost reduction and short inspection time

Pending Publication Date: 2019-07-26
JIANGSU INST OF PARASITIC DISEASES +1
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main steps of this method are filtration, elution, concentration, separation and purification, fluorescence color development and microscopic examination. The main disadvantage of this method is that the volume of water sample required is large, and the operation is very complicated, with many steps and high operation requirements. The errors in microscopic examination are also relatively large, and it is easy to miss detection and cause false negatives. The effect of species determination and traceability is not ideal. It takes 2-3 days to complete the entire detection
In addition, the cost of testing per sample is high if this method is used
[0005] In view of the shortcomings of the existing detection technology such as long time, inconvenient operation and high false negatives, a primer, probe and detection method for the detection of Cryptosporidium by RAA fluorescence method are provided to make it fast, sensitive, easy to operate, and suitable for laboratories And on-site rapid detection is a problem that those skilled in the art need to solve urgently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and detection method for detecting cryptosporidium by RAA fluorescence method
  • Primer, probe and detection method for detecting cryptosporidium by RAA fluorescence method
  • Primer, probe and detection method for detecting cryptosporidium by RAA fluorescence method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 selects cryptosporidium 18S rRNA gene conservative sequence and carries out primer, probe design

[0036] According to the gene name Cryptosporidium 18S rRNA gene, find the corresponding whole gene sequence in genebank (www.ncbi.nlm.nih.gov), use DNASTAR software for homology analysis and b1ast sequence analysis, and screen out Cryptosporidium 18S The highly conserved sequence of the rRNA gene is as follows:

[0037] GACATATCATTCAAGTTTCTGACCTATCAGCTTTAGACGGTAGGGTATTGGCCTACCGTGGCTATGACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTAATACAGGGAGGTAGTGACAAGAAATAACAATACAGAGCCTTACGGTTTTGTAATTGGAATGAGTTAAGTATAAACCCCTTAACAAGTATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTT;SEQ ID NO.1;

[0038]Use the highly conserved sequence as the target gene for detection, synthesize positive plasmids and design primers and probes;

[0039] According to the above conserved sequence of ...

Embodiment 2

[0075] A kind of method that RAA fluorescence method detects cryptosporidium, comprises the steps:

[0076] (1) The sample to be tested is Cryptosporidium oocyst, and the nucleic acid is extracted by lysing, magnetic bead enrichment, washing, elution and other steps, and stored at -20°C for later use;

[0077] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 to preheat, and set the reaction parameters. The reaction parameters are set to 39° C., and the reaction time is 15 minutes.

[0078] (3) Add 2 μL of primers and 0.5 μL of probes at a concentration of 10 μM to 42.5 μL of reaction buffer, mix well, add to RAA fluorescent basic reaction reagent and mix to obtain a reaction premix;

[0079] (4) Fully mix 5 μL of the RNA extract obtained in the step (1) with the reaction premix obtained in the step (3), and put the obtained reaction system into a constant temperature fluorescent gene detector RAA-F1620 to detect the fluorescent signal ;

[0080] (5) A...

Embodiment 3

[0081] Embodiment 3 Sensitivity experiment

[0082] (1) Primers, probes and negative quality controls are the same as in Example 1

[0083] (2) Preparation of working standards:

[0084] Transfer 5 μL of the plasmid to Escherichia coli and extract it at a concentration of 10 10 Copies / μL DNA plasmids made of different gradient working standards are:

[0085] Working Standard 1, containing 1.0 × 10 6 Copies / μL Cryptosporidium target gene DNA fragment.

[0086] Working Standard 2, containing 1.0 × 10 5 Copies / μL Cryptosporidium target gene DNA fragment.

[0087] Working Standard 3, containing 1.0 × 10 4 Copies / μL Cryptosporidium target gene DNA fragment.

[0088] Working Standard 4, containing 1.0 × 10 3 Copies / μL Cryptosporidium target gene DNA fragment.

[0089] Working Standard 5, containing 1.0 × 10 2 Copies / μL Cryptosporidium target gene DNA fragment.

[0090] (3) Specific implementation steps of detection sensitivity:

[0091] Step 1, prepare reaction solution:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a primer, probe and detection method for detecting cryptosporidium by an RAA fluorescence method. The method can conveniently, quickly and accurately identify the cryptosporidium, the operation is simple and convenient, the detection time is short, and the detection is completed within 15 min. The detection method achieves high throughput quickly and easily, and the detection cost is greatly reduced. The sensitivity is high, and the detection sensitivity of each reaction reaches 100 copies / reaction; and one cryptosporidium oocyst can be detected by sample verification.

Description

technical field [0001] The invention relates to the technical field of molecular biology detection, and more specifically relates to a primer, a probe and a detection method for detecting Cryptosporidium by RAA fluorescence method. Background technique [0002] Cryptosporidium is a common type of apicomplexan parasitic protozoan that parasitizes in humans and animals. More than 170 species of vertebrates, including infectious oocysts, are excreted with the host's feces. Humans or animals ingest water or food contaminated by Cryptosporidium oocysts and become infected with cryptosporidiosis, manifested as nausea and diarrhea and cramps etc. The oocyst in the infection stage is a biological incubation period in the water environment. It does not self-replicate and multiply, and can resist common disinfectants in drinking water. It can survive in water and soil for several months, and can even survive in water at 4°C. 1 year long. The diameter of Cryptosporidium oocysts is 4...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6893C12N15/11
CPCC12Q1/6893C12Q1/6844C12Q2521/507C12Q2563/107Y02A50/30
Inventor 戴洋倪碧娴曹俊茅范贞羊海涛郭利川刘燕红王智宏应清界
Owner JIANGSU INST OF PARASITIC DISEASES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com