Primer, probe and detection method for detecting cryptosporidium by RAA fluorescence method
A technology of cryptosporidium and fluorescence method, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of long time, inconvenient operation, large error, etc. Effects of cost reduction and short inspection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1 selects cryptosporidium 18S rRNA gene conservative sequence and carries out primer, probe design
[0036] According to the gene name Cryptosporidium 18S rRNA gene, find the corresponding whole gene sequence in genebank (www.ncbi.nlm.nih.gov), use DNASTAR software for homology analysis and b1ast sequence analysis, and screen out Cryptosporidium 18S The highly conserved sequence of the rRNA gene is as follows:
[0037] GACATATCATTCAAGTTTCTGACCTATCAGCTTTAGACGGTAGGGTATTGGCCTACCGTGGCTATGACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTAATACAGGGAGGTAGTGACAAGAAATAACAATACAGAGCCTTACGGTTTTGTAATTGGAATGAGTTAAGTATAAACCCCTTAACAAGTATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTT;SEQ ID NO.1;
[0038]Use the highly conserved sequence as the target gene for detection, synthesize positive plasmids and design primers and probes;
[0039] According to the above conserved sequence of ...
Embodiment 2
[0075] A kind of method that RAA fluorescence method detects cryptosporidium, comprises the steps:
[0076] (1) The sample to be tested is Cryptosporidium oocyst, and the nucleic acid is extracted by lysing, magnetic bead enrichment, washing, elution and other steps, and stored at -20°C for later use;
[0077] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 to preheat, and set the reaction parameters. The reaction parameters are set to 39° C., and the reaction time is 15 minutes.
[0078] (3) Add 2 μL of primers and 0.5 μL of probes at a concentration of 10 μM to 42.5 μL of reaction buffer, mix well, add to RAA fluorescent basic reaction reagent and mix to obtain a reaction premix;
[0079] (4) Fully mix 5 μL of the RNA extract obtained in the step (1) with the reaction premix obtained in the step (3), and put the obtained reaction system into a constant temperature fluorescent gene detector RAA-F1620 to detect the fluorescent signal ;
[0080] (5) A...
Embodiment 3
[0081] Embodiment 3 Sensitivity experiment
[0082] (1) Primers, probes and negative quality controls are the same as in Example 1
[0083] (2) Preparation of working standards:
[0084] Transfer 5 μL of the plasmid to Escherichia coli and extract it at a concentration of 10 10 Copies / μL DNA plasmids made of different gradient working standards are:
[0085] Working Standard 1, containing 1.0 × 10 6 Copies / μL Cryptosporidium target gene DNA fragment.
[0086] Working Standard 2, containing 1.0 × 10 5 Copies / μL Cryptosporidium target gene DNA fragment.
[0087] Working Standard 3, containing 1.0 × 10 4 Copies / μL Cryptosporidium target gene DNA fragment.
[0088] Working Standard 4, containing 1.0 × 10 3 Copies / μL Cryptosporidium target gene DNA fragment.
[0089] Working Standard 5, containing 1.0 × 10 2 Copies / μL Cryptosporidium target gene DNA fragment.
[0090] (3) Specific implementation steps of detection sensitivity:
[0091] Step 1, prepare reaction solution:...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com