Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A non-aflatoxin-producing strain δaflsnt2 and its application in the control of Aspergillus flavus pollution

An aflatoxin and strain technology, applied in the field of microbiology, can solve the problems of unknown, the pathogenicity of Aspergillus flavus and other problems, and achieve the effects of reducing cost, reducing the infection rate of toxin-producing Aspergillus flavus, and controlling pollution

Active Publication Date: 2021-03-02
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research report on the Snt2 transcription factor in Aspergillus flavus, so it is unknown whether Snt2 has an effect on the pathogenicity of Aspergillus flavus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A non-aflatoxin-producing strain δaflsnt2 and its application in the control of Aspergillus flavus pollution
  • A non-aflatoxin-producing strain δaflsnt2 and its application in the control of Aspergillus flavus pollution
  • A non-aflatoxin-producing strain δaflsnt2 and its application in the control of Aspergillus flavus pollution

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1, in Aspergillus flavus aflsnt2 gene knockout

[0045] Aspergillus flavus aflsnt2 Gene function in Aspergillus flavus morphogenesis and virulence expression, first knockout in Aspergillus flavus aflsnt2 Gene.

[0046] figure 1 A shows the strategy for gene knockout. in vitro construction aflsnt2 Gene knockout fragments, through the method of homologous recombination, the chromosome aflsnt2 The 3.5 kb DNA fragment in the gene was used Afpyr replacement, thereby knocking out the chromosomal aflsnt2 Gene.

[0047] The specific method is as follows:

[0048] Using the 5' primer CTTCTCGAATTCCCCTTCATGACACTCTCC (SEQ ID NO: 3); and the 3' primer GCTAAATCAGGATGGGTTGGAGGGTGAC (SEQ ID NO: 4); the upstream fragment of about 1.2 kb was amplified by PCR from the genomic DNA of Aspergillus flavus CA14 strain;

[0049] Using the 5' primer GTCACCCCTCCAACCCATCCTGATTTAGCGCCTCAAACAATGCTCTTCACCC (SEQ ID NO: 5); and the 3' primer ACACGGTCCAAACAACACAAAGGAGATGCGTC...

Embodiment 2

[0052] Embodiment 2, aflsnt2 The Effect of Gene Knockout on Sporulation of Aspergillus flavus

[0053] Knockout in Aspergillus flavus by homologous recombination aflsnt2 Gene, Southern blot analysis confirmed that the knockout was successful. to detect aflsnt2 Whether the deletion of the gene will affect the spore production of Aspergillus flavus, the inventors placed it on the PDA medium at 37°C ( figure 2 A) Cultivate in the dark for 5 days, and observe the sporulation of the following strains. Compared with wild-type strain WT and anaplerotic strain, ⊿ aflsnt2 The number of green spores produced by the strain was significantly reduced, as indicated by the statistical analysis of the data ( figure 2 B).

[0054] This result shows that, aflsnt2 Gene deletion affects sporulation in Aspergillus flavus.

Embodiment 3

[0055] Embodiment 3, aflsnt2 Effect of gene knockout on toxin production of Aspergillus flavus

[0056] to detect aflsnt2 Whether the deletion of the gene can affect the toxin production of Aspergillus flavus, the inventor inoculated the spores to a final concentration of 10 in the YES liquid medium. 6 cells / ml, cultured statically for 6 days under continuous dark conditions at 29°C, extracted the toxin, and analyzed the toxin production of each strain by TLC. The results showed that the WT strain produced a large amount of aflatoxins AFB1 and AFB2, while ⊿ aflsnt2 AFB1 and AFB2 are obviously not produced, and the statistical analysis of the data also shows this ( image 3 A, 3B).

[0057] The inventors simultaneously detected the regulatory genes of the aflatoxin biosynthesis pathway by qRT-PCR R with AfllS , and some structural genes AfllC with AfllO the transcription level of actin As an internal control for transcriptional analysis. Compared with the WT str...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a strain that does not produce aflatoxin Δ Aflsnt2 And the method for preventing and treating Aspergillus flavus pollution, the pathogenicity-related gene of Aspergillus flavus in the described non-toxic strain afllsnt2 Basically no expression. The invention is beneficial to fundamentally eliminate the generation and accumulation of aflatoxin in the early stage of aflatoxin pollution, thereby effectively controlling and reducing the infection rate of toxin-producing aflatoxin on crops, and achieving the purpose of effectively controlling aflatoxin pollution. Compared with the above-mentioned aflatoxin pollution detection means and post-pollution detoxification technology, the present invention controls the pollution of aflatoxin from the source, and the cost is significantly reduced.

Description

technical field [0001] The invention belongs to the field of microbiology, and in particular relates to a non-aflatoxin-producing bacterial strain ΔAflsnt2 And the application of preventing and controlling the pollution of Aspergillus flavus. Background technique [0002] The Aspergillus genus currently includes more than 200 different species, Aspergillus flavus ( Aspergillus flavus ) is one of the common asexual species belonging to saprophytic fungi and second only to Aspergillus fumigatus ( Aspergillus fumigatus ) of the second largest pathogenic fungi [1] , widely distributed in soil, air, water, plants and agricultural products in nature. Aspergillus flavus is also a zoonotic pathogen, which can grow and reproduce parasitically in grain, food and feed, and produce aflatoxin, among which aflatoxin B1 (Aflatoxin B1, AFB1) is the most harmful and is the most harmful toxin found so far. One of the highly carcinogenic and toxic natural pollutants. According to the re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/37C07K14/38C12N1/15
CPCC07K14/38
Inventor 庄振宏刘亚举胡育乐汪世华郭志强张孟娟袁军张峰
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com