Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Strain Delta Aflsnt2 which does not produce aflatoxin and application in aspergillus flavus prevention and control

A technology of aflatoxin and bacterial strains, applied in the field of microbiology, can solve the problems of unknown and pathogenicity of Aspergillus aflatoxin, and achieve the effects of cost reduction, infection rate of toxin-producing Aspergillus aflatoxin, and pollution control

Active Publication Date: 2019-04-23
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research report on the Snt2 transcription factor in Aspergillus flavus, so it is unknown whether Snt2 has an effect on the pathogenicity of Aspergillus flavus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strain Delta Aflsnt2 which does not produce aflatoxin and application in aspergillus flavus prevention and control
  • Strain Delta Aflsnt2 which does not produce aflatoxin and application in aspergillus flavus prevention and control
  • Strain Delta Aflsnt2 which does not produce aflatoxin and application in aspergillus flavus prevention and control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1, in Aspergillus flavus aflsnt2 gene knockout

[0045] Aspergillus flavus aflsnt2 Gene function in Aspergillus flavus morphogenesis and virulence expression, first knockout in Aspergillus flavus aflsnt2 Gene.

[0046] figure 1 A shows the strategy for gene knockout. in vitro construction aflsnt2 Gene knockout fragments, through the method of homologous recombination, the chromosome aflsnt2 The 3.5 kb DNA fragment in the gene was used Afpyr replacement, thereby knocking out the chromosomal aflsnt2 Gene.

[0047] The specific method is as follows:

[0048] Using the 5' primer CTTCTCGAATTCCCCTTCATGACACTCTCC (SEQ ID NO: 3); and the 3' primer GCTAAATCAGGATGGGTTGGAGGGTGAC (SEQ ID NO: 4); the upstream fragment of about 1.2 kb was amplified by PCR from the genomic DNA of Aspergillus flavus CA14 strain;

[0049] Using the 5' primer GTCACCCCTCCAACCCATCCTGATTTAGCGCCTCAAACAATGCTCTTCACCC (SEQ ID NO: 5); and the 3' primer ACACGGTCCAAACAACACAAAGGAGATGCGTC...

Embodiment 2

[0052] Embodiment 2, aflsnt2 The Effect of Gene Knockout on Sporulation of Aspergillus flavus

[0053] Knockout in Aspergillus flavus by homologous recombination aflsnt2 Gene, Southern blot analysis confirmed that the knockout was successful. to detect aflsnt2 Whether the deletion of the gene will affect the spore production of Aspergillus flavus, the inventors placed it on the PDA medium at 37°C ( figure 2 A) Cultivate in the dark for 5 days, and observe the sporulation of the following strains. Compared with wild-type strain WT and anaplerotic strain, ⊿ aflsnt2 The number of green spores produced by the strain was significantly reduced, as indicated by the statistical analysis of the data ( figure 2 B).

[0054] This result shows that, aflsnt2 Gene deletion affects sporulation in Aspergillus flavus.

Embodiment 3

[0055] Embodiment 3, aflsnt2 Effect of gene knockout on toxin production of Aspergillus flavus

[0056] to detect aflsnt2 Whether the deletion of the gene can affect the toxin production of Aspergillus flavus, the inventor inoculated the spores to a final concentration of 10 in the YES liquid medium. 6 cells / ml, cultured statically for 6 days under continuous dark conditions at 29°C, extracted the toxin, and analyzed the toxin production of each strain by TLC. The results showed that the WT strain produced a large amount of aflatoxins AFB1 and AFB2, while ⊿ aflsnt2 AFB1 and AFB2 are obviously not produced, and the statistical analysis of the data also shows this ( image 3 A, 3B).

[0057] The inventors simultaneously detected the regulatory genes of the aflatoxin biosynthesis pathway by qRT-PCR R and AfllS , and some structural genes AfllC and AfllO the transcription level of actin As an internal control for transcriptional analysis. Compared with the WT strai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a strain Delta Aflsnt2 which does not produce aflatoxin and application in aspergillus flavus prevention and control. The pathogenic related gene afllsnt2 of aspergillus flavusin the toxic strain which does not produce aflatoxin is not expressed substantially. The strain is conductive to fundamental elimination of the aflatoxin production and accumulation at the early stageof aflatoxin contamination, thus the possibility is effectively controlled and reduced that crops are infected with toxigenic aspergillus flavus, and the purpose of effectively controlling the aflatoxin contamination is achieved. Compared with an aflatoxin contamination detecting means and a post-contamination detoxification technique, the contamination of aspergillus flavus is controlled from the source, and the cost is remarkably lowered.

Description

technical field [0001] The invention belongs to the field of microbiology, and in particular relates to a non-aflatoxin-producing bacterial strain ΔAflsnt2 And the application of preventing and controlling the pollution of Aspergillus flavus. Background technique [0002] The Aspergillus genus currently includes more than 200 different species, Aspergillus flavus ( Aspergillus flavus ) is one of the common asexual species belonging to saprophytic fungi and second only to Aspergillus fumigatus ( Aspergillus fumigatus ) of the second largest pathogenic fungi [1] , widely distributed in soil, air, water, plants and agricultural products in nature. Aspergillus flavus is also a zoonotic pathogen, which can grow and reproduce parasitically in grain, food and feed, and produce aflatoxin, among which aflatoxin B1 (Aflatoxin B1, AFB1) is the most harmful and is the most harmful toxin found so far. One of the highly carcinogenic and toxic natural pollutants. According to the re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/37C07K14/38C12N1/15
CPCC07K14/38
Inventor 庄振宏刘亚举胡育乐汪世华郭志强张孟娟袁军张峰
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com