Supercharge Your Innovation With Domain-Expert AI Agents!

Use of lnc-talc as a molecular marker in evaluating the efficacy and prognosis of glioblastoma TMZ chemotherapy

A glioblastoma, application technology, applied in the field of medicine, can solve problems such as unpredictable patients

Active Publication Date: 2021-09-24
HARBIN MEDICAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because it is currently impossible to predict which patients will benefit from

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of lnc-talc as a molecular marker in evaluating the efficacy and prognosis of glioblastoma TMZ chemotherapy
  • Use of lnc-talc as a molecular marker in evaluating the efficacy and prognosis of glioblastoma TMZ chemotherapy
  • Use of lnc-talc as a molecular marker in evaluating the efficacy and prognosis of glioblastoma TMZ chemotherapy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 The IC50 of drug-resistant glioblastoma cells TMZ was significantly increased

[0032] IC50 refers to the concentration at which the measured drug induces half of the tumor cells to die. The IC50 value can be used to measure the ability of the drug to induce apoptosis. Cell tolerance to drugs. Temozolomide IC50 values ​​were calculated using cell growth curves for glioblastoma cell lines LN229 and U251 and primary cells 551W and HG7. The 1 / 50 IC50 concentration of each cell was used as the initial concentration, and the TMZ concentration was doubled and increased in 15 days as a cycle until 5 months, and drug-resistant glioblastoma cells 229R, 251R, 551WR and HG7R were successfully induced.

[0033] The experimental method is as follows: Glioblastoma cells were cultured in a 96-well plate, and when they were 70-80% confluent, the cells were treated with temozolomide at concentrations of 0 μM, 25 μM, 50 μM, 100 μM, 200 μM, and 400 μM for 72 hours, and then 10 ...

Embodiment 2

[0035] Screening and identification of embodiment 2lnc-TALC

[0036] Using the lncRNA chip to analyze the lncRNA level of the successfully constructed drug-resistant glioblastoma cell 229R and the parental cell LN229, the hybridization and analysis of the lncRNA chip were provided by Shanghai Bohao Biological Company. The microarray results showed that there was a significant difference in lncRNA expression levels between drug-resistant glioblastoma cells and parental cells, and the inventors selected 10 lncRNAs with the largest up-regulation differences in drug-resistant glioblastoma cells, respectively in LN229 / 229R , U251 / 251R, 551W / 551WR, HG7 / HG7R four groups of cells extracted RNA verified by qPCR ( figure 2 ).

[0037] In order to verify whether these lncRNAs play a role in glioblastoma TMZ drug resistance, the inventors used the siDirect website (http: / / sidirect2.rnai.jp / ) to design siRNA sequences and entrusted Shanghai Jikai Gene Company to synthesize them (Table 1 )...

Embodiment 3

[0041] Example 3 High expression of lnc-TALC in the tissues of patients with recurrent glioblastoma

[0042] The expression levels of lnc-TALC in tissue samples from 79 clinically recurrent glioblastoma patients and primary glioblastoma patients were evaluated by qPCR and ISH techniques.

[0043] 1. The sequence of lnc-TALC:

[0044] Use the Ensemble database to query the full-length sequence of lnc-TALC, which includes 2 exons and 328 bases, and the sequence is shown in SEQ ID NO.5.

[0045] 2. Design lnc-TALC primers

[0046] For the sequence of lnc-TALC, the forward and reverse primers of qPCR were designed using the Primer Blast website, and the primers were synthesized by Unionwell.

[0047] Forward primer (5'-3'): TTTGAAATGCTCTTTGAGGGAT (SEQ ID NO.1)

[0048] Reverse primer (5'-3'): TGCAGGTTGTCTGAAGTTGGA (SEQ ID NO.2)

[0049] 3. Extract the total RNA in clinical primary and recurrent glioblastoma tissues, and use qPCR and ISH techniques to detect the expression leve...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the use of lnc-TALC as a molecular marker in evaluating the curative effect and prognosis of glioblastoma TMZ chemotherapy. The present invention uses the lnc-RNA chip and combines clinical data and in vitro and in vivo experimental results to find that lnc-TALC is highly expressed in drug-resistant glioblastoma cells. After knocking down, the IC50 of drug-resistant cells to TMZ is significantly reduced. The expression level of lnc-TALC in tumor tissues of patients with glioblastoma was much higher than that in tumor tissues of patients with primary glioblastoma. The high expression of lnc-TALC is closely related to TMZ chemotherapy resistance in glioblastoma, which indicates that lnc-TALC can be used as a molecular marker for temozolomide treatment in glioblastoma patients to evaluate the efficacy of temozolomide treatment in glioblastoma patients. In addition, the present invention also proposes the use of lnc-TALC siRNA in preparing a reagent for reversing the resistance of glioblastoma to the alkylating agent temozolomide. The proposal of the present invention provides technical means for the treatment of glioblastoma and overcoming TMZ chemotherapy resistance of glioblastoma patients.

Description

technical field [0001] The invention relates to a molecular marker for treating glioblastoma with TMZ, a kit for detecting glioblastoma lnc-TALC and its application in evaluating the curative effect and prognosis of TMZ chemotherapy. The invention belongs to the technical field of medicine. Background technique [0002] Glioblastoma is the most malignant primary intracranial tumor, with a high recurrence rate and short survival time. For glioblastoma, comprehensive treatment strategies such as maximal surgical resection, radiotherapy, and chemotherapy are currently emphasized. However, the survival prognosis of patients is extremely poor, and the median survival period is about 12-14 months. A large number of clinical studies have shown that glioblastoma with the same conventional pathological diagnosis has significant differences in the effect of various treatments and clinical prognosis. Therefore, traditional clinical prognostic factors such as age have extremely limite...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/106C12Q2600/118C12Q2600/178
Inventor 蔡金全伍鹏飞蒋传路
Owner HARBIN MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More